FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624591_at:

>probe:Drosophila_2:1624591_at:14:231; Interrogation_Position=1023; Antisense; AATGTGCACATCCTGCTCAAGCGCA
>probe:Drosophila_2:1624591_at:618:323; Interrogation_Position=1043; Antisense; GCGCATCAATCAATCGCTGGTCTTC
>probe:Drosophila_2:1624591_at:631:461; Interrogation_Position=1106; Antisense; GATTATGCATATTCTAGCACCGGTG
>probe:Drosophila_2:1624591_at:357:647; Interrogation_Position=1135; Antisense; TCAGGTACAATATTCCGCAGGTCAA
>probe:Drosophila_2:1624591_at:289:77; Interrogation_Position=1159; Antisense; AGGAGGACCCTTGGTATTCGCCTAG
>probe:Drosophila_2:1624591_at:724:339; Interrogation_Position=1193; Antisense; GCTACTCGTTTATGGTGCAGTGCAA
>probe:Drosophila_2:1624591_at:328:259; Interrogation_Position=703; Antisense; CACGTACGCTATTCAAGCAGCTGGT
>probe:Drosophila_2:1624591_at:717:177; Interrogation_Position=816; Antisense; AAACTGATCGACTTCGGGTTCGCAA
>probe:Drosophila_2:1624591_at:394:379; Interrogation_Position=853; Antisense; GAACCTCCGACAACCAAGTGATACT
>probe:Drosophila_2:1624591_at:301:513; Interrogation_Position=870; Antisense; GTGATACTCTCGAAAACCTTCTGCG
>probe:Drosophila_2:1624591_at:381:101; Interrogation_Position=917; Antisense; AGAGATCCTCAAGGGCGTCGCCTAT
>probe:Drosophila_2:1624591_at:555:631; Interrogation_Position=934; Antisense; TCGCCTATGATCCTTTCATGTCGGA
>probe:Drosophila_2:1624591_at:30:649; Interrogation_Position=949; Antisense; TCATGTCGGACATCTGGGCCTGCGG
>probe:Drosophila_2:1624591_at:712:277; Interrogation_Position=983; Antisense; CTATGCGATGGTCTTTGGACGCCTT

Paste this into a BLAST search page for me
AATGTGCACATCCTGCTCAAGCGCAGCGCATCAATCAATCGCTGGTCTTCGATTATGCATATTCTAGCACCGGTGTCAGGTACAATATTCCGCAGGTCAAAGGAGGACCCTTGGTATTCGCCTAGGCTACTCGTTTATGGTGCAGTGCAACACGTACGCTATTCAAGCAGCTGGTAAACTGATCGACTTCGGGTTCGCAAGAACCTCCGACAACCAAGTGATACTGTGATACTCTCGAAAACCTTCTGCGAGAGATCCTCAAGGGCGTCGCCTATTCGCCTATGATCCTTTCATGTCGGATCATGTCGGACATCTGGGCCTGCGGCTATGCGATGGTCTTTGGACGCCTT

Full Affymetrix probeset data:

Annotations for 1624591_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720