FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624592_at:

>probe:Drosophila_2:1624592_at:628:255; Interrogation_Position=519; Antisense; CACAGTCTTTTTGAACGGCTACCAT
>probe:Drosophila_2:1624592_at:288:571; Interrogation_Position=535; Antisense; GGCTACCATGGCGACTGTTCGGAAA
>probe:Drosophila_2:1624592_at:398:547; Interrogation_Position=603; Antisense; GGAGGCCACTAAATCCTGTTTGGAT
>probe:Drosophila_2:1624592_at:481:545; Interrogation_Position=624; Antisense; GGATCAGTGCATTTCGCTGTGCGGC
>probe:Drosophila_2:1624592_at:38:325; Interrogation_Position=644; Antisense; GCGGCCCCGGTGTGGAATTCAATGA
>probe:Drosophila_2:1624592_at:654:457; Interrogation_Position=689; Antisense; GATATTGCGACGAACATGATCTGGC
>probe:Drosophila_2:1624592_at:730:451; Interrogation_Position=706; Antisense; GATCTGGCATCGATAGCTGCTTTCA
>probe:Drosophila_2:1624592_at:509:119; Interrogation_Position=720; Antisense; AGCTGCTTTCATTGGACATGGAATC
>probe:Drosophila_2:1624592_at:700:561; Interrogation_Position=739; Antisense; GGAATCGGTAGCTATTTCCACGGCC
>probe:Drosophila_2:1624592_at:138:463; Interrogation_Position=792; Antisense; GATTCCTGGAAAGATGCAGCCCGGC
>probe:Drosophila_2:1624592_at:206:5; Interrogation_Position=829; Antisense; ATTGAACCCATTCTGTCCCTGGGCG
>probe:Drosophila_2:1624592_at:305:273; Interrogation_Position=891; Antisense; CATTAGTTTGGATGGCGCACGTAGC
>probe:Drosophila_2:1624592_at:274:295; Interrogation_Position=924; Antisense; CGAGCACACCATTCTGATAACCGAG
>probe:Drosophila_2:1624592_at:235:363; Interrogation_Position=999; Antisense; GCAATTTTTATTCGTGATTCCCATA

Paste this into a BLAST search page for me
CACAGTCTTTTTGAACGGCTACCATGGCTACCATGGCGACTGTTCGGAAAGGAGGCCACTAAATCCTGTTTGGATGGATCAGTGCATTTCGCTGTGCGGCGCGGCCCCGGTGTGGAATTCAATGAGATATTGCGACGAACATGATCTGGCGATCTGGCATCGATAGCTGCTTTCAAGCTGCTTTCATTGGACATGGAATCGGAATCGGTAGCTATTTCCACGGCCGATTCCTGGAAAGATGCAGCCCGGCATTGAACCCATTCTGTCCCTGGGCGCATTAGTTTGGATGGCGCACGTAGCCGAGCACACCATTCTGATAACCGAGGCAATTTTTATTCGTGATTCCCATA

Full Affymetrix probeset data:

Annotations for 1624592_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720