FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624593_at:

>probe:Drosophila_2:1624593_at:41:347; Interrogation_Position=108; Antisense; GCATCAGTCTGGAGCTATTTCATCT
>probe:Drosophila_2:1624593_at:358:341; Interrogation_Position=121; Antisense; GCTATTTCATCTAGAGCTCCAGCTG
>probe:Drosophila_2:1624593_at:156:119; Interrogation_Position=141; Antisense; AGCTGCCGGAATAACCCGTGGCTAC
>probe:Drosophila_2:1624593_at:25:413; Interrogation_Position=188; Antisense; GACCCATCTCTGGATATGGATCCCT
>probe:Drosophila_2:1624593_at:623:45; Interrogation_Position=207; Antisense; ATCCCTCTCTGGTCCTGTTGGAGGA
>probe:Drosophila_2:1624593_at:269:589; Interrogation_Position=225; Antisense; TGGAGGATCCCGTCGAGTGCCCGTA
>probe:Drosophila_2:1624593_at:321:675; Interrogation_Position=248; Antisense; TAGTTGGAGTGACCGGATCTCGTCC
>probe:Drosophila_2:1624593_at:6:703; Interrogation_Position=29; Antisense; TTTTGGTGATCAGTGTCCTGCTTGT
>probe:Drosophila_2:1624593_at:561:679; Interrogation_Position=291; Antisense; TAGTCCGTCTGCTGGAGCTCATGGA
>probe:Drosophila_2:1624593_at:256:533; Interrogation_Position=328; Antisense; GGTGGATCTGCCCATGGAAATTCCT
>probe:Drosophila_2:1624593_at:352:559; Interrogation_Position=343; Antisense; GGAAATTCCTACCAGAATCGCCAAC
>probe:Drosophila_2:1624593_at:640:311; Interrogation_Position=362; Antisense; GCCAACGCAGCCAAAAGCCTTATTA
>probe:Drosophila_2:1624593_at:406:727; Interrogation_Position=50; Antisense; TTGTCCTCGCCCAAGGATCGTATTT
>probe:Drosophila_2:1624593_at:482:449; Interrogation_Position=65; Antisense; GATCGTATTTGTCGTCGGTGAATCA

Paste this into a BLAST search page for me
GCATCAGTCTGGAGCTATTTCATCTGCTATTTCATCTAGAGCTCCAGCTGAGCTGCCGGAATAACCCGTGGCTACGACCCATCTCTGGATATGGATCCCTATCCCTCTCTGGTCCTGTTGGAGGATGGAGGATCCCGTCGAGTGCCCGTATAGTTGGAGTGACCGGATCTCGTCCTTTTGGTGATCAGTGTCCTGCTTGTTAGTCCGTCTGCTGGAGCTCATGGAGGTGGATCTGCCCATGGAAATTCCTGGAAATTCCTACCAGAATCGCCAACGCCAACGCAGCCAAAAGCCTTATTATTGTCCTCGCCCAAGGATCGTATTTGATCGTATTTGTCGTCGGTGAATCA

Full Affymetrix probeset data:

Annotations for 1624593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720