FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624594_at:

>probe:Drosophila_2:1624594_at:687:569; Interrogation_Position=2125; Antisense; GGCATCATCACGGTCGACGGCGAGC
>probe:Drosophila_2:1624594_at:190:205; Interrogation_Position=2171; Antisense; AAGCTGAGGTCCTGCCGGGCATAGC
>probe:Drosophila_2:1624594_at:13:27; Interrogation_Position=2191; Antisense; ATAGCCCGCGTCATGGTGCCCAAGT
>probe:Drosophila_2:1624594_at:101:549; Interrogation_Position=2217; Antisense; GGAGGAGCTTACTGAAGACCATCAA
>probe:Drosophila_2:1624594_at:615:37; Interrogation_Position=2251; Antisense; ATCTCAATTTTGGAATCTCTGCATT
>probe:Drosophila_2:1624594_at:363:563; Interrogation_Position=2262; Antisense; GGAATCTCTGCATTTGTAGCTAATA
>probe:Drosophila_2:1624594_at:578:485; Interrogation_Position=2277; Antisense; GTAGCTAATACTTAGGGTCCCAGGT
>probe:Drosophila_2:1624594_at:586:703; Interrogation_Position=2288; Antisense; TTAGGGTCCCAGGTGGCCGATATGA
>probe:Drosophila_2:1624594_at:705:427; Interrogation_Position=2315; Antisense; GAGTTGTGCATTCTACATATTTCGT
>probe:Drosophila_2:1624594_at:19:271; Interrogation_Position=2330; Antisense; CATATTTCGTGTTTTTGTGGCCTGC
>probe:Drosophila_2:1624594_at:471:619; Interrogation_Position=2352; Antisense; TGCTTCTGCCAACCAATCATGTATT
>probe:Drosophila_2:1624594_at:693:313; Interrogation_Position=2443; Antisense; GCCATATGAAGTGCACGTGAATTTA
>probe:Drosophila_2:1624594_at:178:245; Interrogation_Position=2462; Antisense; AATTTATTTTTATCTCGGCTGTTCA
>probe:Drosophila_2:1624594_at:192:365; Interrogation_Position=2677; Antisense; GAATATAACATCTTTGAGCTTGAAA

Paste this into a BLAST search page for me
GGCATCATCACGGTCGACGGCGAGCAAGCTGAGGTCCTGCCGGGCATAGCATAGCCCGCGTCATGGTGCCCAAGTGGAGGAGCTTACTGAAGACCATCAAATCTCAATTTTGGAATCTCTGCATTGGAATCTCTGCATTTGTAGCTAATAGTAGCTAATACTTAGGGTCCCAGGTTTAGGGTCCCAGGTGGCCGATATGAGAGTTGTGCATTCTACATATTTCGTCATATTTCGTGTTTTTGTGGCCTGCTGCTTCTGCCAACCAATCATGTATTGCCATATGAAGTGCACGTGAATTTAAATTTATTTTTATCTCGGCTGTTCAGAATATAACATCTTTGAGCTTGAAA

Full Affymetrix probeset data:

Annotations for 1624594_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720