FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624596_at:

>probe:Drosophila_2:1624596_at:206:619; Interrogation_Position=1006; Antisense; TGCATTACCTACGTGAATCCGGATA
>probe:Drosophila_2:1624596_at:233:537; Interrogation_Position=1026; Antisense; GGATAAGCCCGACTTCGAATTCACG
>probe:Drosophila_2:1624596_at:130:637; Interrogation_Position=1040; Antisense; TCGAATTCACGCATCCCGAAGAGGA
>probe:Drosophila_2:1624596_at:147:691; Interrogation_Position=1069; Antisense; TATTGGAACACTGGCGCTGATCCTC
>probe:Drosophila_2:1624596_at:554:603; Interrogation_Position=1086; Antisense; TGATCCTCCGGAAATACCCCATGAA
>probe:Drosophila_2:1624596_at:209:141; Interrogation_Position=1138; Antisense; ACGGACTATCCGGAGTTGGACGACT
>probe:Drosophila_2:1624596_at:595:205; Interrogation_Position=1178; Antisense; AAGCTTTGGAATTTCACCCATTGAT
>probe:Drosophila_2:1624596_at:332:309; Interrogation_Position=692; Antisense; CCATGGCCTTGGTAATGCGCATTCA
>probe:Drosophila_2:1624596_at:296:289; Interrogation_Position=807; Antisense; CGTTGGCAAAATCCTGTCGGGTACA
>probe:Drosophila_2:1624596_at:126:501; Interrogation_Position=822; Antisense; GTCGGGTACAGTAAACGCTCTCAGT
>probe:Drosophila_2:1624596_at:62:501; Interrogation_Position=877; Antisense; GTCGGAATCGATGTCTACGGCAAAA
>probe:Drosophila_2:1624596_at:632:77; Interrogation_Position=920; Antisense; AGGAGGCCATCCACTCTGCGGAGTG
>probe:Drosophila_2:1624596_at:194:85; Interrogation_Position=948; Antisense; AGTGGTGTTCGTCAACAGCATACCC
>probe:Drosophila_2:1624596_at:520:109; Interrogation_Position=992; Antisense; AGAATCTGACCACTTGCATTACCTA

Paste this into a BLAST search page for me
TGCATTACCTACGTGAATCCGGATAGGATAAGCCCGACTTCGAATTCACGTCGAATTCACGCATCCCGAAGAGGATATTGGAACACTGGCGCTGATCCTCTGATCCTCCGGAAATACCCCATGAAACGGACTATCCGGAGTTGGACGACTAAGCTTTGGAATTTCACCCATTGATCCATGGCCTTGGTAATGCGCATTCACGTTGGCAAAATCCTGTCGGGTACAGTCGGGTACAGTAAACGCTCTCAGTGTCGGAATCGATGTCTACGGCAAAAAGGAGGCCATCCACTCTGCGGAGTGAGTGGTGTTCGTCAACAGCATACCCAGAATCTGACCACTTGCATTACCTA

Full Affymetrix probeset data:

Annotations for 1624596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720