FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624599_at:

>probe:Drosophila_2:1624599_at:96:425; Interrogation_Position=126; Antisense; GAGACGAATGTTCCCGATATTCCCG
>probe:Drosophila_2:1624599_at:114:135; Interrogation_Position=163; Antisense; ACGAACTGGGCATCGATTTCGGAGA
>probe:Drosophila_2:1624599_at:622:203; Interrogation_Position=207; Antisense; AAGCCACTGGGCATATTCACGATCA
>probe:Drosophila_2:1624599_at:329:13; Interrogation_Position=221; Antisense; ATTCACGATCAAGGTGCGCCACATT
>probe:Drosophila_2:1624599_at:490:153; Interrogation_Position=307; Antisense; ACAGCTACTGCAAACGCCAAGGTCA
>probe:Drosophila_2:1624599_at:633:193; Interrogation_Position=319; Antisense; AACGCCAAGGTCACTGGGTGGGCCA
>probe:Drosophila_2:1624599_at:369:517; Interrogation_Position=336; Antisense; GTGGGCCAGTGCAAGAAGGACATCT
>probe:Drosophila_2:1624599_at:714:151; Interrogation_Position=355; Antisense; ACATCTGTCAGTGCTTTTCCTAGGT
>probe:Drosophila_2:1624599_at:248:79; Interrogation_Position=376; Antisense; AGGTCTACTTCGACTGTAAGCCAAA
>probe:Drosophila_2:1624599_at:521:443; Interrogation_Position=41; Antisense; GATGAGCGCAATAAAGCCCGCCCTG
>probe:Drosophila_2:1624599_at:86:701; Interrogation_Position=412; Antisense; TTTTTTCTTTTGTTGAGTGCAGCAC
>probe:Drosophila_2:1624599_at:700:497; Interrogation_Position=553; Antisense; GTCTTTGACCTTCTAACATGCACTG
>probe:Drosophila_2:1624599_at:593:129; Interrogation_Position=84; Antisense; ACCATCGGTCTGTTCCTTGGTCAAG
>probe:Drosophila_2:1624599_at:524:629; Interrogation_Position=97; Antisense; TCCTTGGTCAAGGTCGGGCGAATCC

Paste this into a BLAST search page for me
GAGACGAATGTTCCCGATATTCCCGACGAACTGGGCATCGATTTCGGAGAAAGCCACTGGGCATATTCACGATCAATTCACGATCAAGGTGCGCCACATTACAGCTACTGCAAACGCCAAGGTCAAACGCCAAGGTCACTGGGTGGGCCAGTGGGCCAGTGCAAGAAGGACATCTACATCTGTCAGTGCTTTTCCTAGGTAGGTCTACTTCGACTGTAAGCCAAAGATGAGCGCAATAAAGCCCGCCCTGTTTTTTCTTTTGTTGAGTGCAGCACGTCTTTGACCTTCTAACATGCACTGACCATCGGTCTGTTCCTTGGTCAAGTCCTTGGTCAAGGTCGGGCGAATCC

Full Affymetrix probeset data:

Annotations for 1624599_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720