Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624600_at:

>probe:Drosophila_2:1624600_at:412:617; Interrogation_Position=123; Antisense; TGCAGGAGATGGTCCTGCCCAGGAC
>probe:Drosophila_2:1624600_at:462:591; Interrogation_Position=14; Antisense; TGGGAGATCAGCCAAAGGCAACGAC
>probe:Drosophila_2:1624600_at:597:225; Interrogation_Position=28; Antisense; AAGGCAACGACAACCGCAACCGGAG
>probe:Drosophila_2:1624600_at:659:517; Interrogation_Position=326; Antisense; GTGGAATTGTGGGTCCGCCCAGCCC
>probe:Drosophila_2:1624600_at:39:327; Interrogation_Position=383; Antisense; GCGAGCCGCACTCCGAGGAGCACAA
>probe:Drosophila_2:1624600_at:299:225; Interrogation_Position=406; Antisense; AAGGACAATATCTTGCAGCATCTGC
>probe:Drosophila_2:1624600_at:106:617; Interrogation_Position=419; Antisense; TGCAGCATCTGCTCAAGGGTTTGTT
>probe:Drosophila_2:1624600_at:597:337; Interrogation_Position=429; Antisense; GCTCAAGGGTTTGTTGATCCTCGAT
>probe:Drosophila_2:1624600_at:564:467; Interrogation_Position=441; Antisense; GTTGATCCTCGATATTCAAGCAGAA
>probe:Drosophila_2:1624600_at:52:115; Interrogation_Position=459; Antisense; AGCAGAAAATTCGTGCCGCTTGTTT
>probe:Drosophila_2:1624600_at:620:625; Interrogation_Position=472; Antisense; TGCCGCTTGTTTGCCAGTGAAATTT
>probe:Drosophila_2:1624600_at:397:175; Interrogation_Position=509; Antisense; AAACCGAGGCCAAGAAAATATCATT
>probe:Drosophila_2:1624600_at:465:117; Interrogation_Position=57; Antisense; AGCTGGCCCAGTTCCTGAAGGCGAC
>probe:Drosophila_2:1624600_at:372:371; Interrogation_Position=73; Antisense; GAAGGCGACGCCGTGATGGCCACCA

Paste this into a BLAST search page for me
TGCAGGAGATGGTCCTGCCCAGGACTGGGAGATCAGCCAAAGGCAACGACAAGGCAACGACAACCGCAACCGGAGGTGGAATTGTGGGTCCGCCCAGCCCGCGAGCCGCACTCCGAGGAGCACAAAAGGACAATATCTTGCAGCATCTGCTGCAGCATCTGCTCAAGGGTTTGTTGCTCAAGGGTTTGTTGATCCTCGATGTTGATCCTCGATATTCAAGCAGAAAGCAGAAAATTCGTGCCGCTTGTTTTGCCGCTTGTTTGCCAGTGAAATTTAAACCGAGGCCAAGAAAATATCATTAGCTGGCCCAGTTCCTGAAGGCGACGAAGGCGACGCCGTGATGGCCACCA

Full Affymetrix probeset data:

Annotations for 1624600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime