Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624602_at:

>probe:Drosophila_2:1624602_at:30:63; Interrogation_Position=13; Antisense; ATGTCGTCGCAGCTCGACATAGACA
>probe:Drosophila_2:1624602_at:156:133; Interrogation_Position=137; Antisense; ACCCACGTCAACTGGCTGTCTTCGT
>probe:Drosophila_2:1624602_at:593:139; Interrogation_Position=141; Antisense; ACGTCAACTGGCTGTCTTCGTGTGC
>probe:Drosophila_2:1624602_at:196:197; Interrogation_Position=146; Antisense; AACTGGCTGTCTTCGTGTGCCTGTT
>probe:Drosophila_2:1624602_at:260:501; Interrogation_Position=15; Antisense; GTCGTCGCAGCTCGACATAGACAAA
>probe:Drosophila_2:1624602_at:107:333; Interrogation_Position=151; Antisense; GCTGTCTTCGTGTGCCTGTTGCCAA
>probe:Drosophila_2:1624602_at:706:497; Interrogation_Position=154; Antisense; GTCTTCGTGTGCCTGTTGCCAACTT
>probe:Drosophila_2:1624602_at:595:275; Interrogation_Position=156; Antisense; CTTCGTGTGCCTGTTGCCAACTTGA
>probe:Drosophila_2:1624602_at:722:501; Interrogation_Position=18; Antisense; GTCGCAGCTCGACATAGACAAATGT
>probe:Drosophila_2:1624602_at:579:335; Interrogation_Position=24; Antisense; GCTCGACATAGACAAATGTTGCTCT
>probe:Drosophila_2:1624602_at:427:677; Interrogation_Position=32; Antisense; TAGACAAATGTTGCTCTTGTCACAA
>probe:Drosophila_2:1624602_at:79:169; Interrogation_Position=37; Antisense; AAATGTTGCTCTTGTCACAAGTGGA
>probe:Drosophila_2:1624602_at:674:595; Interrogation_Position=40; Antisense; TGTTGCTCTTGTCACAAGTGGAGGA
>probe:Drosophila_2:1624602_at:140:645; Interrogation_Position=46; Antisense; TCTTGTCACAAGTGGAGGAGGCAGC

Paste this into a BLAST search page for me
ATGTCGTCGCAGCTCGACATAGACAACCCACGTCAACTGGCTGTCTTCGTACGTCAACTGGCTGTCTTCGTGTGCAACTGGCTGTCTTCGTGTGCCTGTTGTCGTCGCAGCTCGACATAGACAAAGCTGTCTTCGTGTGCCTGTTGCCAAGTCTTCGTGTGCCTGTTGCCAACTTCTTCGTGTGCCTGTTGCCAACTTGAGTCGCAGCTCGACATAGACAAATGTGCTCGACATAGACAAATGTTGCTCTTAGACAAATGTTGCTCTTGTCACAAAAATGTTGCTCTTGTCACAAGTGGATGTTGCTCTTGTCACAAGTGGAGGATCTTGTCACAAGTGGAGGAGGCAGC

Full Affymetrix probeset data:

Annotations for 1624602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime