FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624606_at:

>probe:Drosophila_2:1624606_at:615:127; Interrogation_Position=122; Antisense; ACCACCATCATGTGGAACCACTGCA
>probe:Drosophila_2:1624606_at:38:103; Interrogation_Position=176; Antisense; AGAGCTCCACGGTGGTGCACAGTGT
>probe:Drosophila_2:1624606_at:568:389; Interrogation_Position=18; Antisense; GAAACTGGTAGTGTCGCTACTCTCA
>probe:Drosophila_2:1624606_at:375:267; Interrogation_Position=195; Antisense; CAGTGTGCCGCACCACATAATCAAG
>probe:Drosophila_2:1624606_at:551:351; Interrogation_Position=204; Antisense; GCACCACATAATCAAGCCGGTCCTG
>probe:Drosophila_2:1624606_at:566:123; Interrogation_Position=218; Antisense; AGCCGGTCCTGCTGCCCACTGTGGT
>probe:Drosophila_2:1624606_at:346:535; Interrogation_Position=240; Antisense; GGTGAAGACAGTGGTGCATCCGCCC
>probe:Drosophila_2:1624606_at:535:105; Interrogation_Position=245; Antisense; AGACAGTGGTGCATCCGCCCATCAT
>probe:Drosophila_2:1624606_at:146:679; Interrogation_Position=26; Antisense; TAGTGTCGCTACTCTCAATTTGCGC
>probe:Drosophila_2:1624606_at:261:37; Interrogation_Position=265; Antisense; ATCATCAAGGCTTATCATCCTGCGC
>probe:Drosophila_2:1624606_at:174:245; Interrogation_Position=42; Antisense; AATTTGCGCCTTGACGGCAGCTCGT
>probe:Drosophila_2:1624606_at:320:119; Interrogation_Position=60; Antisense; AGCTCGTCCTGGTTTCCTGCATGGC
>probe:Drosophila_2:1624606_at:152:33; Interrogation_Position=92; Antisense; ATCACTATCCGGAAATCCCTTACTA
>probe:Drosophila_2:1624606_at:333:47; Interrogation_Position=98; Antisense; ATCCGGAAATCCCTTACTATCCACA

Paste this into a BLAST search page for me
ACCACCATCATGTGGAACCACTGCAAGAGCTCCACGGTGGTGCACAGTGTGAAACTGGTAGTGTCGCTACTCTCACAGTGTGCCGCACCACATAATCAAGGCACCACATAATCAAGCCGGTCCTGAGCCGGTCCTGCTGCCCACTGTGGTGGTGAAGACAGTGGTGCATCCGCCCAGACAGTGGTGCATCCGCCCATCATTAGTGTCGCTACTCTCAATTTGCGCATCATCAAGGCTTATCATCCTGCGCAATTTGCGCCTTGACGGCAGCTCGTAGCTCGTCCTGGTTTCCTGCATGGCATCACTATCCGGAAATCCCTTACTAATCCGGAAATCCCTTACTATCCACA

Full Affymetrix probeset data:

Annotations for 1624606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720