FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624609_at:

>probe:Drosophila_2:1624609_at:428:647; Interrogation_Position=1034; Antisense; TCATCACGTGGATCGGCAAGCTGGA
>probe:Drosophila_2:1624609_at:117:223; Interrogation_Position=1063; Antisense; AAGGGCTGGCTGTTCCTGATTCTCA
>probe:Drosophila_2:1624609_at:57:647; Interrogation_Position=1085; Antisense; TCAGAGGAAGCTTTTTCGTTTTCGC
>probe:Drosophila_2:1624609_at:338:409; Interrogation_Position=1183; Antisense; GACGATGCACCCGAGACATTTATGT
>probe:Drosophila_2:1624609_at:511:57; Interrogation_Position=1204; Antisense; ATGTTGGACTCCAGTTCTCAATCCA
>probe:Drosophila_2:1624609_at:140:521; Interrogation_Position=742; Antisense; GGGCCACCATCGCATGAGAAGTCAG
>probe:Drosophila_2:1624609_at:227:243; Interrogation_Position=778; Antisense; AATTTGCGTAAGCTAACCCTGGCCG
>probe:Drosophila_2:1624609_at:9:695; Interrogation_Position=825; Antisense; TTTGCAGGATGGTCAGTCCGAGCCG
>probe:Drosophila_2:1624609_at:266:503; Interrogation_Position=850; Antisense; GTCGCAGTTGAACCCACAATCGAGA
>probe:Drosophila_2:1624609_at:665:183; Interrogation_Position=888; Antisense; AAAATCGCCATTTGAGGTGCCCATG
>probe:Drosophila_2:1624609_at:686:49; Interrogation_Position=910; Antisense; ATGCTAACGCAGCTCTATTACGACT
>probe:Drosophila_2:1624609_at:679:657; Interrogation_Position=927; Antisense; TTACGACTGGTATCTTCCTTTAAGG
>probe:Drosophila_2:1624609_at:432:237; Interrogation_Position=978; Antisense; AATCGGTGCCATAGGTGATCCCAGT
>probe:Drosophila_2:1624609_at:690:445; Interrogation_Position=994; Antisense; GATCCCAGTCCACAAAATGTCTCAT

Paste this into a BLAST search page for me
TCATCACGTGGATCGGCAAGCTGGAAAGGGCTGGCTGTTCCTGATTCTCATCAGAGGAAGCTTTTTCGTTTTCGCGACGATGCACCCGAGACATTTATGTATGTTGGACTCCAGTTCTCAATCCAGGGCCACCATCGCATGAGAAGTCAGAATTTGCGTAAGCTAACCCTGGCCGTTTGCAGGATGGTCAGTCCGAGCCGGTCGCAGTTGAACCCACAATCGAGAAAAATCGCCATTTGAGGTGCCCATGATGCTAACGCAGCTCTATTACGACTTTACGACTGGTATCTTCCTTTAAGGAATCGGTGCCATAGGTGATCCCAGTGATCCCAGTCCACAAAATGTCTCAT

Full Affymetrix probeset data:

Annotations for 1624609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720