Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624611_a_at:

>probe:Drosophila_2:1624611_a_at:34:95; Interrogation_Position=192; Antisense; AGTTCCACCGCATCATCAAGGACTT
>probe:Drosophila_2:1624611_a_at:22:535; Interrogation_Position=230; Antisense; GGTGACTTCACCAAGGGCGACGGCA
>probe:Drosophila_2:1624611_a_at:591:271; Interrogation_Position=268; Antisense; CATCTACGGCGAGCGCTTCGAGGAT
>probe:Drosophila_2:1624611_a_at:143:207; Interrogation_Position=302; Antisense; AAGCTGAAGCACTATGGCGCCGGCT
>probe:Drosophila_2:1624611_a_at:311:609; Interrogation_Position=330; Antisense; TGAGCATGGCCAACGCTGGCAAGGA
>probe:Drosophila_2:1624611_a_at:78:141; Interrogation_Position=360; Antisense; ACGGATCGCAGTTCTTCATCACCAC
>probe:Drosophila_2:1624611_a_at:2:47; Interrogation_Position=431; Antisense; ATCCTGTCGGGCATGAATGTGGTGC
>probe:Drosophila_2:1624611_a_at:335:595; Interrogation_Position=448; Antisense; TGTGGTGCGCCAGATCGAGAACTCG
>probe:Drosophila_2:1624611_a_at:162:319; Interrogation_Position=563; Antisense; GCCGATGCCACCGACTAAAGTGTTT
>probe:Drosophila_2:1624611_a_at:23:529; Interrogation_Position=589; Antisense; GGGAGCATGTCATCCATCAGCAACA
>probe:Drosophila_2:1624611_a_at:661:199; Interrogation_Position=636; Antisense; AACGCATAATCGATTTTTCCAGACA
>probe:Drosophila_2:1624611_a_at:28:21; Interrogation_Position=660; Antisense; ATTTGCATTTACCATAGCTCGCCAT
>probe:Drosophila_2:1624611_a_at:326:307; Interrogation_Position=671; Antisense; CCATAGCTCGCCATGTTTATTTACA
>probe:Drosophila_2:1624611_a_at:187:149; Interrogation_Position=693; Antisense; ACATTTCGTTCCGTAAGCAAGTAAT

Paste this into a BLAST search page for me
AGTTCCACCGCATCATCAAGGACTTGGTGACTTCACCAAGGGCGACGGCACATCTACGGCGAGCGCTTCGAGGATAAGCTGAAGCACTATGGCGCCGGCTTGAGCATGGCCAACGCTGGCAAGGAACGGATCGCAGTTCTTCATCACCACATCCTGTCGGGCATGAATGTGGTGCTGTGGTGCGCCAGATCGAGAACTCGGCCGATGCCACCGACTAAAGTGTTTGGGAGCATGTCATCCATCAGCAACAAACGCATAATCGATTTTTCCAGACAATTTGCATTTACCATAGCTCGCCATCCATAGCTCGCCATGTTTATTTACAACATTTCGTTCCGTAAGCAAGTAAT

Full Affymetrix probeset data:

Annotations for 1624611_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime