FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624612_at:

>probe:Drosophila_2:1624612_at:127:71; Interrogation_Position=1040; Antisense; AGGCAGCCTTTGAGAACTTCCAACT
>probe:Drosophila_2:1624612_at:248:247; Interrogation_Position=1087; Antisense; GAATTCTACGTTATGGGTCTCTTTA
>probe:Drosophila_2:1624612_at:151:381; Interrogation_Position=1117; Antisense; GAACGTGGTCGTCTAATCGCTATGC
>probe:Drosophila_2:1624612_at:528:727; Interrogation_Position=619; Antisense; TTGGTGCGCCAAGCTGAATGCATCT
>probe:Drosophila_2:1624612_at:225:551; Interrogation_Position=667; Antisense; GGAGTTTACTCCATTCAGTGCTGCT
>probe:Drosophila_2:1624612_at:180:453; Interrogation_Position=700; Antisense; GATCAGCTGGATCTAATTGCCGAAA
>probe:Drosophila_2:1624612_at:532:425; Interrogation_Position=754; Antisense; GAGATGTCGGACCTTTTCCAGATAC
>probe:Drosophila_2:1624612_at:17:55; Interrogation_Position=790; Antisense; ATGAGCCTGGTGTACTTTTTCTCCA
>probe:Drosophila_2:1624612_at:385:697; Interrogation_Position=832; Antisense; TTTAGCGTCTGTTCGATCCTGTACA
>probe:Drosophila_2:1624612_at:716:147; Interrogation_Position=862; Antisense; ACAGGATTCGGCTCTACATACTGGG
>probe:Drosophila_2:1624612_at:665:715; Interrogation_Position=890; Antisense; TTCTGCTGATTGTACTATCCACGGC
>probe:Drosophila_2:1624612_at:432:139; Interrogation_Position=910; Antisense; ACGGCTTCCTTCTACATGGACAATT
>probe:Drosophila_2:1624612_at:387:73; Interrogation_Position=974; Antisense; AGGACGAACTATTCCGAGTGCTGGC
>probe:Drosophila_2:1624612_at:88:87; Interrogation_Position=990; Antisense; AGTGCTGGCGGATCGAACTCTGTTC

Paste this into a BLAST search page for me
AGGCAGCCTTTGAGAACTTCCAACTGAATTCTACGTTATGGGTCTCTTTAGAACGTGGTCGTCTAATCGCTATGCTTGGTGCGCCAAGCTGAATGCATCTGGAGTTTACTCCATTCAGTGCTGCTGATCAGCTGGATCTAATTGCCGAAAGAGATGTCGGACCTTTTCCAGATACATGAGCCTGGTGTACTTTTTCTCCATTTAGCGTCTGTTCGATCCTGTACAACAGGATTCGGCTCTACATACTGGGTTCTGCTGATTGTACTATCCACGGCACGGCTTCCTTCTACATGGACAATTAGGACGAACTATTCCGAGTGCTGGCAGTGCTGGCGGATCGAACTCTGTTC

Full Affymetrix probeset data:

Annotations for 1624612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720