FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624613_at:

>probe:Drosophila_2:1624613_at:512:575; Interrogation_Position=1009; Antisense; TGACCGAGAAGGTAAACGACGCCTT
>probe:Drosophila_2:1624613_at:172:133; Interrogation_Position=1027; Antisense; ACGCCTTCGAGGAGGGACTCAAGCA
>probe:Drosophila_2:1624613_at:293:563; Interrogation_Position=1082; Antisense; GGAAGCAACTTCCAGTGGCACAAAG
>probe:Drosophila_2:1624613_at:351:169; Interrogation_Position=1151; Antisense; AAAGGGCACACTCTGGATAGACGAT
>probe:Drosophila_2:1624613_at:65:27; Interrogation_Position=1167; Antisense; ATAGACGATGACATCTCTGGATCCG
>probe:Drosophila_2:1624613_at:3:405; Interrogation_Position=1191; Antisense; GACTCTGACTCTGACGACAGCGAGG
>probe:Drosophila_2:1624613_at:460:217; Interrogation_Position=1272; Antisense; AAGTATGTACCAAAGACGTTCTTAT
>probe:Drosophila_2:1624613_at:647:77; Interrogation_Position=758; Antisense; AGGATTTGGTTCCATGCTTCGAGCC
>probe:Drosophila_2:1624613_at:207:637; Interrogation_Position=776; Antisense; TCGAGCCATTGGTGCGCAAATTGAA
>probe:Drosophila_2:1624613_at:391:211; Interrogation_Position=801; Antisense; AAGACAACCAATCGCGAGGCTTGCC
>probe:Drosophila_2:1624613_at:478:439; Interrogation_Position=816; Antisense; GAGGCTTGCCGCGATCTAAGTGGTC
>probe:Drosophila_2:1624613_at:260:657; Interrogation_Position=832; Antisense; TAAGTGGTCGCCGTTTGCGGGATAT
>probe:Drosophila_2:1624613_at:601:505; Interrogation_Position=957; Antisense; GTGCCCAAGCACGACTTTAAGGACG
>probe:Drosophila_2:1624613_at:524:379; Interrogation_Position=993; Antisense; GAAGCCAGGGCTAATCTGACCGAGA

Paste this into a BLAST search page for me
TGACCGAGAAGGTAAACGACGCCTTACGCCTTCGAGGAGGGACTCAAGCAGGAAGCAACTTCCAGTGGCACAAAGAAAGGGCACACTCTGGATAGACGATATAGACGATGACATCTCTGGATCCGGACTCTGACTCTGACGACAGCGAGGAAGTATGTACCAAAGACGTTCTTATAGGATTTGGTTCCATGCTTCGAGCCTCGAGCCATTGGTGCGCAAATTGAAAAGACAACCAATCGCGAGGCTTGCCGAGGCTTGCCGCGATCTAAGTGGTCTAAGTGGTCGCCGTTTGCGGGATATGTGCCCAAGCACGACTTTAAGGACGGAAGCCAGGGCTAATCTGACCGAGA

Full Affymetrix probeset data:

Annotations for 1624613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720