FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624614_at:

>probe:Drosophila_2:1624614_at:218:155; Interrogation_Position=295; Antisense; ACAGTGGACTCTGAGCTAACCATTG
>probe:Drosophila_2:1624614_at:217:423; Interrogation_Position=337; Antisense; GAGAAGGATCTCAGCCCAGAGCAGC
>probe:Drosophila_2:1624614_at:519:155; Interrogation_Position=454; Antisense; ACAGAAGCCTTAGACATTTGCCCCT
>probe:Drosophila_2:1624614_at:319:225; Interrogation_Position=490; Antisense; AAGGAGCGAGCAGTTCTCTACGGAA
>probe:Drosophila_2:1624614_at:238:713; Interrogation_Position=503; Antisense; TTCTCTACGGAAACAGGGCTGCTGC
>probe:Drosophila_2:1624614_at:714:185; Interrogation_Position=547; Antisense; AACAAAGCGGCCATCGACGACTGCA
>probe:Drosophila_2:1624614_at:86:607; Interrogation_Position=602; Antisense; TGAGGGTGCTTTTAAGGCGCGCCAA
>probe:Drosophila_2:1624614_at:649:227; Interrogation_Position=615; Antisense; AAGGCGCGCCAAGCTCTATGAGCAA
>probe:Drosophila_2:1624614_at:470:217; Interrogation_Position=677; Antisense; AAGTTACTGAGATCGATCCCGGTCA
>probe:Drosophila_2:1624614_at:521:267; Interrogation_Position=703; Antisense; CAGGAGGCTCGCGAGGCTCAGATTC
>probe:Drosophila_2:1624614_at:207:555; Interrogation_Position=792; Antisense; GGACCTGGGCAACATGATACTCAAA
>probe:Drosophila_2:1624614_at:103:175; Interrogation_Position=814; Antisense; AAACCGTTCGGACTGTCTACACAGA
>probe:Drosophila_2:1624614_at:30:233; Interrogation_Position=846; Antisense; AATGCAACAGGATCCCAACACGGGC
>probe:Drosophila_2:1624614_at:567:523; Interrogation_Position=867; Antisense; GGGCTCGTATTCCATCAACTTTAAA

Paste this into a BLAST search page for me
ACAGTGGACTCTGAGCTAACCATTGGAGAAGGATCTCAGCCCAGAGCAGCACAGAAGCCTTAGACATTTGCCCCTAAGGAGCGAGCAGTTCTCTACGGAATTCTCTACGGAAACAGGGCTGCTGCAACAAAGCGGCCATCGACGACTGCATGAGGGTGCTTTTAAGGCGCGCCAAAAGGCGCGCCAAGCTCTATGAGCAAAAGTTACTGAGATCGATCCCGGTCACAGGAGGCTCGCGAGGCTCAGATTCGGACCTGGGCAACATGATACTCAAAAAACCGTTCGGACTGTCTACACAGAAATGCAACAGGATCCCAACACGGGCGGGCTCGTATTCCATCAACTTTAAA

Full Affymetrix probeset data:

Annotations for 1624614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720