Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624616_at:

>probe:Drosophila_2:1624616_at:437:499; Interrogation_Position=1592; Antisense; GTCTGCTCGGCACTGCGAAAGATCT
>probe:Drosophila_2:1624616_at:522:171; Interrogation_Position=1609; Antisense; AAAGATCTCCGCCACGGACGAGAAT
>probe:Drosophila_2:1624616_at:624:457; Interrogation_Position=1643; Antisense; GATAGCATCGCTAACATGCTCCACA
>probe:Drosophila_2:1624616_at:282:153; Interrogation_Position=1656; Antisense; ACATGCTCCACAACAGCCTGAATGT
>probe:Drosophila_2:1624616_at:135:563; Interrogation_Position=1706; Antisense; GGAAGTCCGTGCAGTCCGGACAACT
>probe:Drosophila_2:1624616_at:580:397; Interrogation_Position=1724; Antisense; GACAACTCGGATAACTCTACGGCGG
>probe:Drosophila_2:1624616_at:594:553; Interrogation_Position=1770; Antisense; GGACAGCAATGAAACCTTAAGGGAA
>probe:Drosophila_2:1624616_at:548:221; Interrogation_Position=1788; Antisense; AAGGGAACAGATTCTCGGGACCACA
>probe:Drosophila_2:1624616_at:689:637; Interrogation_Position=1802; Antisense; TCGGGACCACAGAGCAGTATAATTC
>probe:Drosophila_2:1624616_at:154:687; Interrogation_Position=1993; Antisense; TATATTACCCGCGAAGTCTCCGATA
>probe:Drosophila_2:1624616_at:239:511; Interrogation_Position=2054; Antisense; GTGAATTGTACTACGCATACACCTT
>probe:Drosophila_2:1624616_at:195:25; Interrogation_Position=2083; Antisense; ATATGCACACGTATCTTTATCTATG
>probe:Drosophila_2:1624616_at:509:277; Interrogation_Position=2103; Antisense; CTATGTCTAGCAGTTGTTTATTCAA
>probe:Drosophila_2:1624616_at:619:239; Interrogation_Position=2158; Antisense; AATAAATTGCAACCTCTCGGTGCGC

Paste this into a BLAST search page for me
GTCTGCTCGGCACTGCGAAAGATCTAAAGATCTCCGCCACGGACGAGAATGATAGCATCGCTAACATGCTCCACAACATGCTCCACAACAGCCTGAATGTGGAAGTCCGTGCAGTCCGGACAACTGACAACTCGGATAACTCTACGGCGGGGACAGCAATGAAACCTTAAGGGAAAAGGGAACAGATTCTCGGGACCACATCGGGACCACAGAGCAGTATAATTCTATATTACCCGCGAAGTCTCCGATAGTGAATTGTACTACGCATACACCTTATATGCACACGTATCTTTATCTATGCTATGTCTAGCAGTTGTTTATTCAAAATAAATTGCAACCTCTCGGTGCGC

Full Affymetrix probeset data:

Annotations for 1624616_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime