FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624617_at:

>probe:Drosophila_2:1624617_at:595:221; Interrogation_Position=1010; Antisense; AAGGTGAAGGCCAACGACGTCGTGT
>probe:Drosophila_2:1624617_at:40:35; Interrogation_Position=1062; Antisense; ATCTCTTCTAACACTTTATCCGGTA
>probe:Drosophila_2:1624617_at:458:75; Interrogation_Position=579; Antisense; AGGAGAGCGGCCTCAAGCTAGTTCA
>probe:Drosophila_2:1624617_at:64:341; Interrogation_Position=595; Antisense; GCTAGTTCACTATCCCTATCCGAAA
>probe:Drosophila_2:1624617_at:314:329; Interrogation_Position=671; Antisense; GAGGACTCGGGCACTTTTAACGATG
>probe:Drosophila_2:1624617_at:153:683; Interrogation_Position=706; Antisense; TATGCTGATGAACCTTTCGTCGGTC
>probe:Drosophila_2:1624617_at:618:535; Interrogation_Position=727; Antisense; GGTCGCCGATCTTAATACTCGGTTA
>probe:Drosophila_2:1624617_at:65:447; Interrogation_Position=764; Antisense; GATGCACTGCAGTTCCGAGGTAACT
>probe:Drosophila_2:1624617_at:235:445; Interrogation_Position=809; Antisense; GATGAGCCCTATGCCGAGGACAATT
>probe:Drosophila_2:1624617_at:249:211; Interrogation_Position=855; Antisense; AAGATGCTGTTTTCCGTACGGTGGC
>probe:Drosophila_2:1624617_at:115:55; Interrogation_Position=883; Antisense; ATGCACTCGCTGTATTTTTACCAAC
>probe:Drosophila_2:1624617_at:374:551; Interrogation_Position=930; Antisense; GGAGTTCCGAAGGAGAGCCTCTCAA
>probe:Drosophila_2:1624617_at:373:181; Interrogation_Position=953; Antisense; AAAACGCTCAGAAGTTCGCCGGCTC
>probe:Drosophila_2:1624617_at:538:337; Interrogation_Position=974; Antisense; GCTCTGGGCGTTCATATGGGACTTC

Paste this into a BLAST search page for me
AAGGTGAAGGCCAACGACGTCGTGTATCTCTTCTAACACTTTATCCGGTAAGGAGAGCGGCCTCAAGCTAGTTCAGCTAGTTCACTATCCCTATCCGAAAGAGGACTCGGGCACTTTTAACGATGTATGCTGATGAACCTTTCGTCGGTCGGTCGCCGATCTTAATACTCGGTTAGATGCACTGCAGTTCCGAGGTAACTGATGAGCCCTATGCCGAGGACAATTAAGATGCTGTTTTCCGTACGGTGGCATGCACTCGCTGTATTTTTACCAACGGAGTTCCGAAGGAGAGCCTCTCAAAAAACGCTCAGAAGTTCGCCGGCTCGCTCTGGGCGTTCATATGGGACTTC

Full Affymetrix probeset data:

Annotations for 1624617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720