Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624618_at:

>probe:Drosophila_2:1624618_at:103:177; Interrogation_Position=1031; Antisense; AAACGGCGCCGTGGAGCATCGAGCA
>probe:Drosophila_2:1624618_at:701:439; Interrogation_Position=1077; Antisense; GAGGCCCAGCTGGTGTTGCTACTAA
>probe:Drosophila_2:1624618_at:541:449; Interrogation_Position=1111; Antisense; GATCCCCAGGATCCACATCTGTGAA
>probe:Drosophila_2:1624618_at:6:407; Interrogation_Position=1163; Antisense; GACTGCAGTTCGAATATGGGCTCAA
>probe:Drosophila_2:1624618_at:227:523; Interrogation_Position=1188; Antisense; GGGCCAGCCAGCATCGTTTAAGCAA
>probe:Drosophila_2:1624618_at:225:99; Interrogation_Position=1267; Antisense; AGATGCAAACTTGGCTTGAAGCTAT
>probe:Drosophila_2:1624618_at:81:285; Interrogation_Position=1303; Antisense; CTGATTAGGCTAGATCCAGGATCCC
>probe:Drosophila_2:1624618_at:486:637; Interrogation_Position=1329; Antisense; TCGATCCACTGACAAGGCGCTGCGA
>probe:Drosophila_2:1624618_at:97:297; Interrogation_Position=1351; Antisense; CGACAACCGCTTCATCATAATCTTA
>probe:Drosophila_2:1624618_at:684:599; Interrogation_Position=1393; Antisense; TGTACAGCAATTGCCGCGTGCATAT
>probe:Drosophila_2:1624618_at:73:53; Interrogation_Position=1419; Antisense; ATGACTTTATACACTCGTTTCGCTC
>probe:Drosophila_2:1624618_at:512:205; Interrogation_Position=1445; Antisense; AAGCCCATCTGACTTACCAATCATA
>probe:Drosophila_2:1624618_at:477:527; Interrogation_Position=1490; Antisense; GGGAGCAGCACTCACGAAACACTCA
>probe:Drosophila_2:1624618_at:693:389; Interrogation_Position=1527; Antisense; GAAACACTCACCCACAAGACATTAA

Paste this into a BLAST search page for me
AAACGGCGCCGTGGAGCATCGAGCAGAGGCCCAGCTGGTGTTGCTACTAAGATCCCCAGGATCCACATCTGTGAAGACTGCAGTTCGAATATGGGCTCAAGGGCCAGCCAGCATCGTTTAAGCAAAGATGCAAACTTGGCTTGAAGCTATCTGATTAGGCTAGATCCAGGATCCCTCGATCCACTGACAAGGCGCTGCGACGACAACCGCTTCATCATAATCTTATGTACAGCAATTGCCGCGTGCATATATGACTTTATACACTCGTTTCGCTCAAGCCCATCTGACTTACCAATCATAGGGAGCAGCACTCACGAAACACTCAGAAACACTCACCCACAAGACATTAA

Full Affymetrix probeset data:

Annotations for 1624618_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime