Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624620_at:

>probe:Drosophila_2:1624620_at:194:275; Interrogation_Position=3317; Antisense; CATTGAGCCCGTGGATGGTGTCACC
>probe:Drosophila_2:1624620_at:449:363; Interrogation_Position=3367; Antisense; GCAATTCCAATTCGAACGCCCTAAA
>probe:Drosophila_2:1624620_at:413:175; Interrogation_Position=3389; Antisense; AAAGCCACCCGTAGCTACTGGTGGA
>probe:Drosophila_2:1624620_at:106:177; Interrogation_Position=3414; Antisense; AAACGCAGCAGCTCGTTGTCACGTT
>probe:Drosophila_2:1624620_at:322:649; Interrogation_Position=3432; Antisense; TCACGTTCCCTGACACCCAGTAAAA
>probe:Drosophila_2:1624620_at:150:1; Interrogation_Position=3449; Antisense; CAGTAAAACGTCACCTCGAGGTTCT
>probe:Drosophila_2:1624620_at:651:315; Interrogation_Position=3477; Antisense; GCCTTCGTCAGGCACAACAAAGAAA
>probe:Drosophila_2:1624620_at:323:291; Interrogation_Position=3503; Antisense; CGTAGCCTGATTGCATTCGATGACA
>probe:Drosophila_2:1624620_at:545:637; Interrogation_Position=3519; Antisense; TCGATGACAGTAGTAGTCTCCCCTT
>probe:Drosophila_2:1624620_at:622:629; Interrogation_Position=3543; Antisense; TCCCAGTAACCCGTTTATGTTAGTG
>probe:Drosophila_2:1624620_at:342:679; Interrogation_Position=3563; Antisense; TAGTGGATTTCGGATCGCTGTGTTT
>probe:Drosophila_2:1624620_at:705:449; Interrogation_Position=3575; Antisense; GATCGCTGTGTTTGTTTGGCTCTTC
>probe:Drosophila_2:1624620_at:505:481; Interrogation_Position=3588; Antisense; GTTTGGCTCTTCTGGATATTCATTT
>probe:Drosophila_2:1624620_at:235:653; Interrogation_Position=3779; Antisense; TAATGATGTCATGCCTTCCAAGGAA

Paste this into a BLAST search page for me
CATTGAGCCCGTGGATGGTGTCACCGCAATTCCAATTCGAACGCCCTAAAAAAGCCACCCGTAGCTACTGGTGGAAAACGCAGCAGCTCGTTGTCACGTTTCACGTTCCCTGACACCCAGTAAAACAGTAAAACGTCACCTCGAGGTTCTGCCTTCGTCAGGCACAACAAAGAAACGTAGCCTGATTGCATTCGATGACATCGATGACAGTAGTAGTCTCCCCTTTCCCAGTAACCCGTTTATGTTAGTGTAGTGGATTTCGGATCGCTGTGTTTGATCGCTGTGTTTGTTTGGCTCTTCGTTTGGCTCTTCTGGATATTCATTTTAATGATGTCATGCCTTCCAAGGAA

Full Affymetrix probeset data:

Annotations for 1624620_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime