FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624622_at:

>probe:Drosophila_2:1624622_at:217:57; Interrogation_Position=2872; Antisense; ATGACCTCGTATGCGCTGGACATGA
>probe:Drosophila_2:1624622_at:372:153; Interrogation_Position=2891; Antisense; ACATGATGCGAACCCTGGCCAAGAG
>probe:Drosophila_2:1624622_at:137:41; Interrogation_Position=2974; Antisense; ATCGGCATCTCCAGCGGTGAGGTGA
>probe:Drosophila_2:1624622_at:627:281; Interrogation_Position=3018; Antisense; CTCGCAGCCGCACTACGATATATGG
>probe:Drosophila_2:1624622_at:154:89; Interrogation_Position=3051; Antisense; AGTCAACATGGCCTCGCGGATGGAA
>probe:Drosophila_2:1624622_at:707:423; Interrogation_Position=3112; Antisense; GAGACGTCCGAAATTCTGCAACAGT
>probe:Drosophila_2:1624622_at:367:93; Interrogation_Position=3134; Antisense; AGTTCGGCATTACCTGTTCATATCG
>probe:Drosophila_2:1624622_at:627:23; Interrogation_Position=3153; Antisense; ATATCGCGGCATGACTTTTGTTAAG
>probe:Drosophila_2:1624622_at:704:519; Interrogation_Position=3178; Antisense; GGGCGCGGCAAAATACCAACCTATT
>probe:Drosophila_2:1624622_at:287:423; Interrogation_Position=3217; Antisense; GAGAACCTTAACTTCATTCCACAGA
>probe:Drosophila_2:1624622_at:206:109; Interrogation_Position=3239; Antisense; AGAAGGCAACGCGATTTCCCAGTCA
>probe:Drosophila_2:1624622_at:301:267; Interrogation_Position=3258; Antisense; CAGTCACCAGGAGCGCAGTACGGTT
>probe:Drosophila_2:1624622_at:394:469; Interrogation_Position=3288; Antisense; GTTGCAGTCAACCTATACTCATGCG
>probe:Drosophila_2:1624622_at:181:113; Interrogation_Position=3334; Antisense; AGCACGTCTAGGCACACTTTGCAAA

Paste this into a BLAST search page for me
ATGACCTCGTATGCGCTGGACATGAACATGATGCGAACCCTGGCCAAGAGATCGGCATCTCCAGCGGTGAGGTGACTCGCAGCCGCACTACGATATATGGAGTCAACATGGCCTCGCGGATGGAAGAGACGTCCGAAATTCTGCAACAGTAGTTCGGCATTACCTGTTCATATCGATATCGCGGCATGACTTTTGTTAAGGGGCGCGGCAAAATACCAACCTATTGAGAACCTTAACTTCATTCCACAGAAGAAGGCAACGCGATTTCCCAGTCACAGTCACCAGGAGCGCAGTACGGTTGTTGCAGTCAACCTATACTCATGCGAGCACGTCTAGGCACACTTTGCAAA

Full Affymetrix probeset data:

Annotations for 1624622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720