Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624624_at:

>probe:Drosophila_2:1624624_at:65:135; Interrogation_Position=5770; Antisense; ACGCCGTCGGCGATGGCCGCAATTA
>probe:Drosophila_2:1624624_at:484:439; Interrogation_Position=5781; Antisense; GATGGCCGCAATTAATGCTGCTTTT
>probe:Drosophila_2:1624624_at:423:233; Interrogation_Position=5794; Antisense; AATGCTGCTTTTTATTGGCCTAATT
>probe:Drosophila_2:1624624_at:527:699; Interrogation_Position=5833; Antisense; TTTTTTGTATTACATCCTGTACATA
>probe:Drosophila_2:1624624_at:231:151; Interrogation_Position=5844; Antisense; ACATCCTGTACATAAGTGGCATCAA
>probe:Drosophila_2:1624624_at:230:519; Interrogation_Position=5859; Antisense; GTGGCATCAATGTAATCTTTAAGTC
>probe:Drosophila_2:1624624_at:286:493; Interrogation_Position=5870; Antisense; GTAATCTTTAAGTCGCGCAGTCCTA
>probe:Drosophila_2:1624624_at:341:87; Interrogation_Position=5880; Antisense; AGTCGCGCAGTCCTATCGTGTATTA
>probe:Drosophila_2:1624624_at:267:87; Interrogation_Position=5888; Antisense; AGTCCTATCGTGTATTAGGGCCACA
>probe:Drosophila_2:1624624_at:609:513; Interrogation_Position=5897; Antisense; GTGTATTAGGGCCACACATGACGTG
>probe:Drosophila_2:1624624_at:265:523; Interrogation_Position=5905; Antisense; GGGCCACACATGACGTGGTAGACTT
>probe:Drosophila_2:1624624_at:720:269; Interrogation_Position=5913; Antisense; CATGACGTGGTAGACTTTGTTATAA
>probe:Drosophila_2:1624624_at:644:271; Interrogation_Position=5946; Antisense; CATTTTGTGATATGTACTAAGTCAT
>probe:Drosophila_2:1624624_at:505:213; Interrogation_Position=5979; Antisense; AATGAGCGATTTGTATTTCCAAGAA

Paste this into a BLAST search page for me
ACGCCGTCGGCGATGGCCGCAATTAGATGGCCGCAATTAATGCTGCTTTTAATGCTGCTTTTTATTGGCCTAATTTTTTTTGTATTACATCCTGTACATAACATCCTGTACATAAGTGGCATCAAGTGGCATCAATGTAATCTTTAAGTCGTAATCTTTAAGTCGCGCAGTCCTAAGTCGCGCAGTCCTATCGTGTATTAAGTCCTATCGTGTATTAGGGCCACAGTGTATTAGGGCCACACATGACGTGGGGCCACACATGACGTGGTAGACTTCATGACGTGGTAGACTTTGTTATAACATTTTGTGATATGTACTAAGTCATAATGAGCGATTTGTATTTCCAAGAA

Full Affymetrix probeset data:

Annotations for 1624624_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime