Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624625_a_at:

>probe:Drosophila_2:1624625_a_at:18:81; Interrogation_Position=133; Antisense; AGGGTTTCCCGGGTGCTGCAAATGC
>probe:Drosophila_2:1624625_a_at:35:627; Interrogation_Position=155; Antisense; TGCCGCGCGGCAACATCCTGATGGT
>probe:Drosophila_2:1624625_a_at:559:35; Interrogation_Position=192; Antisense; ATCAGGACGTCGGAGCTCTGCGCGT
>probe:Drosophila_2:1624625_a_at:468:665; Interrogation_Position=226; Antisense; TACATAGCGGACTGCCGGCTTATGA
>probe:Drosophila_2:1624625_a_at:574:143; Interrogation_Position=236; Antisense; ACTGCCGGCTTATGACGGTGCAGGT
>probe:Drosophila_2:1624625_a_at:344:139; Interrogation_Position=250; Antisense; ACGGTGCAGGTGTCCAAGAGCTACA
>probe:Drosophila_2:1624625_a_at:600:213; Interrogation_Position=265; Antisense; AAGAGCTACACCATCACGGATTGGC
>probe:Drosophila_2:1624625_a_at:560:537; Interrogation_Position=28; Antisense; GGTCATGTTCCGTTTTGCTATCGAA
>probe:Drosophila_2:1624625_a_at:464:139; Interrogation_Position=280; Antisense; ACGGATTGGCGCGACGACCTCAAAA
>probe:Drosophila_2:1624625_a_at:710:575; Interrogation_Position=287; Antisense; GGCGCGACGACCTCAAAAAGATACT
>probe:Drosophila_2:1624625_a_at:216:97; Interrogation_Position=305; Antisense; AGATACTAATGTCGGCCAGCTTCAA
>probe:Drosophila_2:1624625_a_at:411:657; Interrogation_Position=311; Antisense; TAATGTCGGCCAGCTTCAATCTTAA
>probe:Drosophila_2:1624625_a_at:346:343; Interrogation_Position=323; Antisense; GCTTCAATCTTAACCACACCGTGTT
>probe:Drosophila_2:1624625_a_at:362:631; Interrogation_Position=36; Antisense; TCCGTTTTGCTATCGAACATGTGAG

Paste this into a BLAST search page for me
AGGGTTTCCCGGGTGCTGCAAATGCTGCCGCGCGGCAACATCCTGATGGTATCAGGACGTCGGAGCTCTGCGCGTTACATAGCGGACTGCCGGCTTATGAACTGCCGGCTTATGACGGTGCAGGTACGGTGCAGGTGTCCAAGAGCTACAAAGAGCTACACCATCACGGATTGGCGGTCATGTTCCGTTTTGCTATCGAAACGGATTGGCGCGACGACCTCAAAAGGCGCGACGACCTCAAAAAGATACTAGATACTAATGTCGGCCAGCTTCAATAATGTCGGCCAGCTTCAATCTTAAGCTTCAATCTTAACCACACCGTGTTTCCGTTTTGCTATCGAACATGTGAG

Full Affymetrix probeset data:

Annotations for 1624625_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime