FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624628_at:

>probe:Drosophila_2:1624628_at:250:191; Interrogation_Position=116; Antisense; AACTTTTCCAGATGACGAGGCGTCG
>probe:Drosophila_2:1624628_at:266:539; Interrogation_Position=160; Antisense; GGTATTCGACTTATGGTCGCCGATC
>probe:Drosophila_2:1624628_at:24:451; Interrogation_Position=181; Antisense; GATCGCCAGGTCGTTGGTCATGGAA
>probe:Drosophila_2:1624628_at:560:63; Interrogation_Position=209; Antisense; ATGGGCGACCCATATACTTCGATAG
>probe:Drosophila_2:1624628_at:102:23; Interrogation_Position=220; Antisense; ATATACTTCGATAGTCCGGACTGCC
>probe:Drosophila_2:1624628_at:19:277; Interrogation_Position=245; Antisense; CTTTTCCGGCTATTCGATATCGGGA
>probe:Drosophila_2:1624628_at:730:307; Interrogation_Position=277; Antisense; CCAGAGTTGTGTGCCCTACGTGAAA
>probe:Drosophila_2:1624628_at:333:703; Interrogation_Position=349; Antisense; TTATACCGATATAGCTTCTGCCAAA
>probe:Drosophila_2:1624628_at:633:99; Interrogation_Position=381; Antisense; AGAATTCCAGCACATTACACCCGAA
>probe:Drosophila_2:1624628_at:258:297; Interrogation_Position=426; Antisense; CGCTTTGTGGCTTGTGTCAATCGGA
>probe:Drosophila_2:1624628_at:153:375; Interrogation_Position=471; Antisense; GAAGACCGTTCTCTATGGAAAACTG
>probe:Drosophila_2:1624628_at:10:29; Interrogation_Position=500; Antisense; ATACGTTTAACGATGAGCGCCAGTC
>probe:Drosophila_2:1624628_at:270:577; Interrogation_Position=536; Antisense; GGCGCATCATCCAGCTGCAAATGAA
>probe:Drosophila_2:1624628_at:123:329; Interrogation_Position=577; Antisense; GCGTCCAAATGGTGCTACCGAGAGA

Paste this into a BLAST search page for me
AACTTTTCCAGATGACGAGGCGTCGGGTATTCGACTTATGGTCGCCGATCGATCGCCAGGTCGTTGGTCATGGAAATGGGCGACCCATATACTTCGATAGATATACTTCGATAGTCCGGACTGCCCTTTTCCGGCTATTCGATATCGGGACCAGAGTTGTGTGCCCTACGTGAAATTATACCGATATAGCTTCTGCCAAAAGAATTCCAGCACATTACACCCGAACGCTTTGTGGCTTGTGTCAATCGGAGAAGACCGTTCTCTATGGAAAACTGATACGTTTAACGATGAGCGCCAGTCGGCGCATCATCCAGCTGCAAATGAAGCGTCCAAATGGTGCTACCGAGAGA

Full Affymetrix probeset data:

Annotations for 1624628_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720