FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624629_at:

>probe:Drosophila_2:1624629_at:593:375; Interrogation_Position=1212; Antisense; GAAGACTATCTTATCGTCGGTCAGT
>probe:Drosophila_2:1624629_at:283:499; Interrogation_Position=1227; Antisense; GTCGGTCAGTGCTGCGTAAGGTTAA
>probe:Drosophila_2:1624629_at:53:43; Interrogation_Position=1311; Antisense; ATCGGGTCCACTGGCTCGCAGAGAA
>probe:Drosophila_2:1624629_at:448:105; Interrogation_Position=1350; Antisense; AGAAATTTACCCGTCGACCTGTGTG
>probe:Drosophila_2:1624629_at:673:291; Interrogation_Position=1361; Antisense; CGTCGACCTGTGTGGATCAATGAGC
>probe:Drosophila_2:1624629_at:271:707; Interrogation_Position=1431; Antisense; TTGGAAAGAACAGCACCTACGTGGT
>probe:Drosophila_2:1624629_at:173:259; Interrogation_Position=1444; Antisense; CACCTACGTGGTTCCCGATAAGTCA
>probe:Drosophila_2:1624629_at:608:255; Interrogation_Position=1467; Antisense; CAAACCATTCCAATTTGTCCTACTC
>probe:Drosophila_2:1624629_at:49:465; Interrogation_Position=1499; Antisense; GATTCCAGCCACTCTTTGCACAACA
>probe:Drosophila_2:1624629_at:162:725; Interrogation_Position=1514; Antisense; TTGCACAACAGAGCCCGCACTTGAT
>probe:Drosophila_2:1624629_at:322:453; Interrogation_Position=1607; Antisense; GATCTTCCCGTGCTGTGCAATCATA
>probe:Drosophila_2:1624629_at:54:23; Interrogation_Position=1643; Antisense; ATATATACTCTTTTTTCCGGCTCTG
>probe:Drosophila_2:1624629_at:250:695; Interrogation_Position=1656; Antisense; TTTCCGGCTCTGTGCAAATGTTTTA
>probe:Drosophila_2:1624629_at:23:183; Interrogation_Position=1727; Antisense; AACAATTTGCAGCTGAGTGAGCGAC

Paste this into a BLAST search page for me
GAAGACTATCTTATCGTCGGTCAGTGTCGGTCAGTGCTGCGTAAGGTTAAATCGGGTCCACTGGCTCGCAGAGAAAGAAATTTACCCGTCGACCTGTGTGCGTCGACCTGTGTGGATCAATGAGCTTGGAAAGAACAGCACCTACGTGGTCACCTACGTGGTTCCCGATAAGTCACAAACCATTCCAATTTGTCCTACTCGATTCCAGCCACTCTTTGCACAACATTGCACAACAGAGCCCGCACTTGATGATCTTCCCGTGCTGTGCAATCATAATATATACTCTTTTTTCCGGCTCTGTTTCCGGCTCTGTGCAAATGTTTTAAACAATTTGCAGCTGAGTGAGCGAC

Full Affymetrix probeset data:

Annotations for 1624629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720