Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624630_at:

>probe:Drosophila_2:1624630_at:328:689; Interrogation_Position=1213; Antisense; TATTAGAGCCTCGATTGACCCTGGG
>probe:Drosophila_2:1624630_at:505:61; Interrogation_Position=1263; Antisense; ATGTGGTCACAGTGCTACCCTTCAG
>probe:Drosophila_2:1624630_at:577:227; Interrogation_Position=1331; Antisense; AAGGCGCTGGAGCATTCAGCCCAAA
>probe:Drosophila_2:1624630_at:457:605; Interrogation_Position=1371; Antisense; TGACCAGTGCCCATTTACAGGTTTC
>probe:Drosophila_2:1624630_at:656:663; Interrogation_Position=1386; Antisense; TACAGGTTTCGGGTCTTCGGCTCAA
>probe:Drosophila_2:1624630_at:453:207; Interrogation_Position=1409; Antisense; AAGTTCAACCACAGTTTGCCCAAGG
>probe:Drosophila_2:1624630_at:143:435; Interrogation_Position=1553; Antisense; GAGGGCTACAGTTTCGTCGATCCAA
>probe:Drosophila_2:1624630_at:493:455; Interrogation_Position=1603; Antisense; GATACTTGATCGCATGGCTGTCATC
>probe:Drosophila_2:1624630_at:108:69; Interrogation_Position=1616; Antisense; ATGGCTGTCATCCAGTATCTGCAGG
>probe:Drosophila_2:1624630_at:421:417; Interrogation_Position=1640; Antisense; GAGCACAAGGTTATCTATCCGGAAC
>probe:Drosophila_2:1624630_at:624:435; Interrogation_Position=1667; Antisense; GAGGATCGCCAATATGTGCAGCATA
>probe:Drosophila_2:1624630_at:368:193; Interrogation_Position=1703; Antisense; AACTCGGGCTACATGTCTCTTGAAC
>probe:Drosophila_2:1624630_at:542:263; Interrogation_Position=1741; Antisense; CAGCTTTTTGTACTTTTGTCACCGA
>probe:Drosophila_2:1624630_at:235:727; Interrogation_Position=1756; Antisense; TTGTCACCGATTTCTCGTTGTCTAG

Paste this into a BLAST search page for me
TATTAGAGCCTCGATTGACCCTGGGATGTGGTCACAGTGCTACCCTTCAGAAGGCGCTGGAGCATTCAGCCCAAATGACCAGTGCCCATTTACAGGTTTCTACAGGTTTCGGGTCTTCGGCTCAAAAGTTCAACCACAGTTTGCCCAAGGGAGGGCTACAGTTTCGTCGATCCAAGATACTTGATCGCATGGCTGTCATCATGGCTGTCATCCAGTATCTGCAGGGAGCACAAGGTTATCTATCCGGAACGAGGATCGCCAATATGTGCAGCATAAACTCGGGCTACATGTCTCTTGAACCAGCTTTTTGTACTTTTGTCACCGATTGTCACCGATTTCTCGTTGTCTAG

Full Affymetrix probeset data:

Annotations for 1624630_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime