Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624633_at:

>probe:Drosophila_2:1624633_at:574:677; Interrogation_Position=1341; Antisense; TAGTAGACCCTGTCGTTTGGCATCC
>probe:Drosophila_2:1624633_at:517:725; Interrogation_Position=1357; Antisense; TTGGCATCCCGACGTGGCATTTCGA
>probe:Drosophila_2:1624633_at:674:583; Interrogation_Position=1371; Antisense; TGGCATTTCGATCCTTCTTATATCC
>probe:Drosophila_2:1624633_at:502:567; Interrogation_Position=1442; Antisense; GGCAGTCTCAGCCTAGTAGATCCTG
>probe:Drosophila_2:1624633_at:432:677; Interrogation_Position=1455; Antisense; TAGTAGATCCTGTCGTTCGGCGTCT
>probe:Drosophila_2:1624633_at:699:105; Interrogation_Position=1551; Antisense; AGCTCGGTATTTGAACTTCCCTCCT
>probe:Drosophila_2:1624633_at:183:93; Interrogation_Position=1586; Antisense; AGTTCACCATCTCTATTTGCTTTGT
>probe:Drosophila_2:1624633_at:483:723; Interrogation_Position=1602; Antisense; TTGCTTTGTTTACATCCACAGCTGT
>probe:Drosophila_2:1624633_at:618:155; Interrogation_Position=1619; Antisense; ACAGCTGTATGGTGTCATCCTTGCT
>probe:Drosophila_2:1624633_at:179:327; Interrogation_Position=1771; Antisense; GCGATCGTACCCGTAGTGCAACCTA
>probe:Drosophila_2:1624633_at:145:511; Interrogation_Position=1786; Antisense; GTGCAACCTACTTCTCATGGATCAA
>probe:Drosophila_2:1624633_at:456:17; Interrogation_Position=1816; Antisense; ATTTCCAGCGCGTTTGTACCTACTT
>probe:Drosophila_2:1624633_at:390:641; Interrogation_Position=1840; Antisense; TCTCCTGGCTTCTGCTTGTACAGAA
>probe:Drosophila_2:1624633_at:566:107; Interrogation_Position=1861; Antisense; AGAACTCCGTCTTCTGTTCGCGATA

Paste this into a BLAST search page for me
TAGTAGACCCTGTCGTTTGGCATCCTTGGCATCCCGACGTGGCATTTCGATGGCATTTCGATCCTTCTTATATCCGGCAGTCTCAGCCTAGTAGATCCTGTAGTAGATCCTGTCGTTCGGCGTCTAGCTCGGTATTTGAACTTCCCTCCTAGTTCACCATCTCTATTTGCTTTGTTTGCTTTGTTTACATCCACAGCTGTACAGCTGTATGGTGTCATCCTTGCTGCGATCGTACCCGTAGTGCAACCTAGTGCAACCTACTTCTCATGGATCAAATTTCCAGCGCGTTTGTACCTACTTTCTCCTGGCTTCTGCTTGTACAGAAAGAACTCCGTCTTCTGTTCGCGATA

Full Affymetrix probeset data:

Annotations for 1624633_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime