FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624634_at:

>probe:Drosophila_2:1624634_at:708:407; Interrogation_Position=204; Antisense; GACGAGCTACAGTTTATTTTGGATG
>probe:Drosophila_2:1624634_at:624:285; Interrogation_Position=280; Antisense; CTGTGGACTTTAGCTGTGACTTTCA
>probe:Drosophila_2:1624634_at:178:511; Interrogation_Position=295; Antisense; GTGACTTTCATACGGATTTACTGGA
>probe:Drosophila_2:1624634_at:273:543; Interrogation_Position=317; Antisense; GGATATTTTTTGTTCCACTAGAATG
>probe:Drosophila_2:1624634_at:44:389; Interrogation_Position=388; Antisense; GAAAATGTCGTTTGCTACAATCATA
>probe:Drosophila_2:1624634_at:590:167; Interrogation_Position=483; Antisense; AAATGGCTGGTATGGTATCCTCAAA
>probe:Drosophila_2:1624634_at:717:683; Interrogation_Position=498; Antisense; TATCCTCAAATCGTCTCAGCTTAAA
>probe:Drosophila_2:1624634_at:437:191; Interrogation_Position=534; Antisense; AACTTGTGTGTCATGCTTGGGCGAA
>probe:Drosophila_2:1624634_at:205:345; Interrogation_Position=548; Antisense; GCTTGGGCGAAGATCTAGTCATCTT
>probe:Drosophila_2:1624634_at:516:689; Interrogation_Position=597; Antisense; TATTCTGGATGCTTATTGCCCTCAC
>probe:Drosophila_2:1624634_at:116:299; Interrogation_Position=616; Antisense; CCTCACCTAGGAGCCAACTTGGGTA
>probe:Drosophila_2:1624634_at:466:3; Interrogation_Position=640; Antisense; ATTGGTGGAAGCGTTGCTGACGACT
>probe:Drosophila_2:1624634_at:496:283; Interrogation_Position=656; Antisense; CTGACGACTGTGTTATATGCCCTTT
>probe:Drosophila_2:1624634_at:545:21; Interrogation_Position=722; Antisense; ATATTCCATATAGCACATCAGGTAA

Paste this into a BLAST search page for me
GACGAGCTACAGTTTATTTTGGATGCTGTGGACTTTAGCTGTGACTTTCAGTGACTTTCATACGGATTTACTGGAGGATATTTTTTGTTCCACTAGAATGGAAAATGTCGTTTGCTACAATCATAAAATGGCTGGTATGGTATCCTCAAATATCCTCAAATCGTCTCAGCTTAAAAACTTGTGTGTCATGCTTGGGCGAAGCTTGGGCGAAGATCTAGTCATCTTTATTCTGGATGCTTATTGCCCTCACCCTCACCTAGGAGCCAACTTGGGTAATTGGTGGAAGCGTTGCTGACGACTCTGACGACTGTGTTATATGCCCTTTATATTCCATATAGCACATCAGGTAA

Full Affymetrix probeset data:

Annotations for 1624634_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720