FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624635_at:

>probe:Drosophila_2:1624635_at:510:551; Interrogation_Position=150; Antisense; GGAGAACAGCATACCACGCGGCCAG
>probe:Drosophila_2:1624635_at:107:379; Interrogation_Position=183; Antisense; GAACCGGCCGTGGAAGACGCCCAAG
>probe:Drosophila_2:1624635_at:109:411; Interrogation_Position=198; Antisense; GACGCCCAAGCAGAAATTTAGCAAG
>probe:Drosophila_2:1624635_at:693:655; Interrogation_Position=237; Antisense; TAACCGACTGTCCTTCGAAAAGAAG
>probe:Drosophila_2:1624635_at:69:407; Interrogation_Position=274; Antisense; GACGAGCTGCGCTACATCAAGGAGC
>probe:Drosophila_2:1624635_at:503:75; Interrogation_Position=326; Antisense; AGGAGGATGCCGTCCAAAAGCACCA
>probe:Drosophila_2:1624635_at:309:129; Interrogation_Position=347; Antisense; ACCAGCGCCGCGTGGAGAATGCCGA
>probe:Drosophila_2:1624635_at:685:639; Interrogation_Position=397; Antisense; TCGGAGGTCGTCCAGGTCATCAAGA
>probe:Drosophila_2:1624635_at:445:497; Interrogation_Position=412; Antisense; GTCATCAAGAATCCCGCCAAGCTGA
>probe:Drosophila_2:1624635_at:690:297; Interrogation_Position=460; Antisense; CGCATGATCGAGAAGCGGGACGTCA
>probe:Drosophila_2:1624635_at:365:223; Interrogation_Position=493; Antisense; AAGGTGGTCTGAGGTGGCTCCATTA
>probe:Drosophila_2:1624635_at:247:533; Interrogation_Position=505; Antisense; GGTGGCTCCATTAGATTAACTTGTA
>probe:Drosophila_2:1624635_at:389:183; Interrogation_Position=79; Antisense; AAAATGAGTGAATCCGCACCGGAAA
>probe:Drosophila_2:1624635_at:688:353; Interrogation_Position=94; Antisense; GCACCGGAAACTGTGCCAGCCAAGA

Paste this into a BLAST search page for me
GGAGAACAGCATACCACGCGGCCAGGAACCGGCCGTGGAAGACGCCCAAGGACGCCCAAGCAGAAATTTAGCAAGTAACCGACTGTCCTTCGAAAAGAAGGACGAGCTGCGCTACATCAAGGAGCAGGAGGATGCCGTCCAAAAGCACCAACCAGCGCCGCGTGGAGAATGCCGATCGGAGGTCGTCCAGGTCATCAAGAGTCATCAAGAATCCCGCCAAGCTGACGCATGATCGAGAAGCGGGACGTCAAAGGTGGTCTGAGGTGGCTCCATTAGGTGGCTCCATTAGATTAACTTGTAAAAATGAGTGAATCCGCACCGGAAAGCACCGGAAACTGTGCCAGCCAAGA

Full Affymetrix probeset data:

Annotations for 1624635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720