FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624636_at:

>probe:Drosophila_2:1624636_at:62:671; Interrogation_Position=3546; Antisense; TACGAGGGCAACGTGATCACCAGCG
>probe:Drosophila_2:1624636_at:687:33; Interrogation_Position=3579; Antisense; ATCAGTAGCACCCACAACGGGAGCA
>probe:Drosophila_2:1624636_at:269:445; Interrogation_Position=3659; Antisense; GATGCGCCGCTTCAACACGGAGAAC
>probe:Drosophila_2:1624636_at:573:87; Interrogation_Position=3694; Antisense; AGTACGAGGGCAGCACCGACTACGG
>probe:Drosophila_2:1624636_at:283:261; Interrogation_Position=3707; Antisense; CACCGACTACGGCATGCTGAGGATC
>probe:Drosophila_2:1624636_at:596:607; Interrogation_Position=3724; Antisense; TGAGGATCGGCATCTCGCACGGCAG
>probe:Drosophila_2:1624636_at:64:39; Interrogation_Position=3771; Antisense; ATCTCGAAGCCCCACTATGACATCT
>probe:Drosophila_2:1624636_at:311:511; Interrogation_Position=3807; Antisense; GTGAACATGGCCTCGCGCATGGACT
>probe:Drosophila_2:1624636_at:560:577; Interrogation_Position=3846; Antisense; GGCCAGATTCAGGTCACCGAGAACA
>probe:Drosophila_2:1624636_at:366:79; Interrogation_Position=3856; Antisense; AGGTCACCGAGAACACGGCGCTTAA
>probe:Drosophila_2:1624636_at:300:577; Interrogation_Position=3872; Antisense; GGCGCTTAAGCTGCGCGAGTTTAAC
>probe:Drosophila_2:1624636_at:286:661; Interrogation_Position=3893; Antisense; TAACATTCAGTGCAACTACCGCGGC
>probe:Drosophila_2:1624636_at:49:569; Interrogation_Position=3963; Antisense; GGCATCGACAGCGAATACCAGTTCC
>probe:Drosophila_2:1624636_at:603:575; Interrogation_Position=4001; Antisense; GGCCGCGCCAACCAAAGAAGACTAG

Paste this into a BLAST search page for me
TACGAGGGCAACGTGATCACCAGCGATCAGTAGCACCCACAACGGGAGCAGATGCGCCGCTTCAACACGGAGAACAGTACGAGGGCAGCACCGACTACGGCACCGACTACGGCATGCTGAGGATCTGAGGATCGGCATCTCGCACGGCAGATCTCGAAGCCCCACTATGACATCTGTGAACATGGCCTCGCGCATGGACTGGCCAGATTCAGGTCACCGAGAACAAGGTCACCGAGAACACGGCGCTTAAGGCGCTTAAGCTGCGCGAGTTTAACTAACATTCAGTGCAACTACCGCGGCGGCATCGACAGCGAATACCAGTTCCGGCCGCGCCAACCAAAGAAGACTAG

Full Affymetrix probeset data:

Annotations for 1624636_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720