FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624637_at:

>probe:Drosophila_2:1624637_at:186:617; Interrogation_Position=1509; Antisense; TGCAGGCACTAATTCAGCGTTTCCC
>probe:Drosophila_2:1624637_at:329:35; Interrogation_Position=1548; Antisense; ATCACGGCGTGCTCATGCTGAACAA
>probe:Drosophila_2:1624637_at:685:135; Interrogation_Position=1591; Antisense; ACGACAGTCAAAGAGCCCCGAGGCA
>probe:Drosophila_2:1624637_at:368:373; Interrogation_Position=1634; Antisense; GAAGTGGATGATGGCTTCCGCTACC
>probe:Drosophila_2:1624637_at:722:199; Interrogation_Position=1670; Antisense; AACGCCGAATATGATCTCCGTTCCA
>probe:Drosophila_2:1624637_at:525:567; Interrogation_Position=1696; Antisense; GGCACGCGACTATATGCAACGCTAT
>probe:Drosophila_2:1624637_at:316:681; Interrogation_Position=1718; Antisense; TATGTGGGCCACTGCAACGTCACGA
>probe:Drosophila_2:1624637_at:166:93; Interrogation_Position=1782; Antisense; AGTTCATAGCCGCTGGTTCGGATGA
>probe:Drosophila_2:1624637_at:296:95; Interrogation_Position=1842; Antisense; AGATACGCGCCGTTTATCGGGCGGA
>probe:Drosophila_2:1624637_at:485:41; Interrogation_Position=1857; Antisense; ATCGGGCGGACAGTGCCATCGTGAA
>probe:Drosophila_2:1624637_at:530:661; Interrogation_Position=1936; Antisense; TAACATTAAGATCTGGTCGCCGTGC
>probe:Drosophila_2:1624637_at:282:411; Interrogation_Position=1980; Antisense; GACCCAATCTCGTGGCGGATGTGAC
>probe:Drosophila_2:1624637_at:523:109; Interrogation_Position=2028; Antisense; AGAAGATGCGCCTCGATCCATTCGA
>probe:Drosophila_2:1624637_at:547:299; Interrogation_Position=2061; Antisense; CGCGCAATGCGTACTGTTTCAATAA

Paste this into a BLAST search page for me
TGCAGGCACTAATTCAGCGTTTCCCATCACGGCGTGCTCATGCTGAACAAACGACAGTCAAAGAGCCCCGAGGCAGAAGTGGATGATGGCTTCCGCTACCAACGCCGAATATGATCTCCGTTCCAGGCACGCGACTATATGCAACGCTATTATGTGGGCCACTGCAACGTCACGAAGTTCATAGCCGCTGGTTCGGATGAAGATACGCGCCGTTTATCGGGCGGAATCGGGCGGACAGTGCCATCGTGAATAACATTAAGATCTGGTCGCCGTGCGACCCAATCTCGTGGCGGATGTGACAGAAGATGCGCCTCGATCCATTCGACGCGCAATGCGTACTGTTTCAATAA

Full Affymetrix probeset data:

Annotations for 1624637_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720