Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624639_at:

>probe:Drosophila_2:1624639_at:673:347; Interrogation_Position=1299; Antisense; GCAGTTTCTGGAACGCCGGACGCTG
>probe:Drosophila_2:1624639_at:645:219; Interrogation_Position=1331; Antisense; AAGTGCTGCAAGTCCTTCATCAAGA
>probe:Drosophila_2:1624639_at:396:33; Interrogation_Position=1349; Antisense; ATCAAGAACTCCTACTGCGTGGGCA
>probe:Drosophila_2:1624639_at:156:435; Interrogation_Position=1385; Antisense; GAGGGCTACTCGGAACATCATTCTA
>probe:Drosophila_2:1624639_at:608:385; Interrogation_Position=1397; Antisense; GAACATCATTCTACGAGCTCCACTG
>probe:Drosophila_2:1624639_at:487:143; Interrogation_Position=1418; Antisense; ACTGCAGCGGCTACTACAGAACCTG
>probe:Drosophila_2:1624639_at:723:665; Interrogation_Position=1432; Antisense; TACAGAACCTGCAGCTCAAAGCCAA
>probe:Drosophila_2:1624639_at:652:107; Interrogation_Position=1468; Antisense; AGAAGTGCCACCTGAAAGGCCCACT
>probe:Drosophila_2:1624639_at:729:147; Interrogation_Position=1490; Antisense; ACTTCCGAAGTGGACTCAGCATCGA
>probe:Drosophila_2:1624639_at:565:687; Interrogation_Position=1678; Antisense; TATTCCCGAGGAACTGGACGATCGC
>probe:Drosophila_2:1624639_at:180:557; Interrogation_Position=1693; Antisense; GGACGATCGCAAACGAGCCTATAAC
>probe:Drosophila_2:1624639_at:649:347; Interrogation_Position=1719; Antisense; GCATGTATGATGTGAAGGCGCCCAC
>probe:Drosophila_2:1624639_at:247:71; Interrogation_Position=1734; Antisense; AGGCGCCCACAGAGGACGAGATCGA
>probe:Drosophila_2:1624639_at:346:375; Interrogation_Position=1787; Antisense; GAAGATCCCATGCTGCAATTTATGT

Paste this into a BLAST search page for me
GCAGTTTCTGGAACGCCGGACGCTGAAGTGCTGCAAGTCCTTCATCAAGAATCAAGAACTCCTACTGCGTGGGCAGAGGGCTACTCGGAACATCATTCTAGAACATCATTCTACGAGCTCCACTGACTGCAGCGGCTACTACAGAACCTGTACAGAACCTGCAGCTCAAAGCCAAAGAAGTGCCACCTGAAAGGCCCACTACTTCCGAAGTGGACTCAGCATCGATATTCCCGAGGAACTGGACGATCGCGGACGATCGCAAACGAGCCTATAACGCATGTATGATGTGAAGGCGCCCACAGGCGCCCACAGAGGACGAGATCGAGAAGATCCCATGCTGCAATTTATGT

Full Affymetrix probeset data:

Annotations for 1624639_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime