FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624641_at:

>probe:Drosophila_2:1624641_at:400:405; Interrogation_Position=374; Antisense; GACTCTATCTGGAGGCCGACAGATC
>probe:Drosophila_2:1624641_at:23:441; Interrogation_Position=385; Antisense; GAGGCCGACAGATCTGTCAACGACA
>probe:Drosophila_2:1624641_at:227:13; Interrogation_Position=457; Antisense; ATTAAGCGAGTTGCGGGAAATCCTG
>probe:Drosophila_2:1624641_at:1:395; Interrogation_Position=473; Antisense; GAAATCCTGACGAAGTCGGCGATGT
>probe:Drosophila_2:1624641_at:605:679; Interrogation_Position=511; Antisense; TATGAGTAGGAACATTTTATGCCCC
>probe:Drosophila_2:1624641_at:452:89; Interrogation_Position=537; Antisense; AGTCATCTACATACCTAGGAGCTAT
>probe:Drosophila_2:1624641_at:162:609; Interrogation_Position=561; Antisense; TGAGTACAGCAAACCCGCCCATCAA
>probe:Drosophila_2:1624641_at:412:251; Interrogation_Position=583; Antisense; CAAGTCCTATAAGCCGAATCCTGGC
>probe:Drosophila_2:1624641_at:140:369; Interrogation_Position=598; Antisense; GAATCCTGGCAAACGGACATAGATT
>probe:Drosophila_2:1624641_at:175:461; Interrogation_Position=619; Antisense; GATTATCAAATCCACGCTGGGAGCA
>probe:Drosophila_2:1624641_at:374:389; Interrogation_Position=705; Antisense; GAAAAATACGCACTTGCGCTAGCAA
>probe:Drosophila_2:1624641_at:642:323; Interrogation_Position=720; Antisense; GCGCTAGCAATTTCCACAACCAATA
>probe:Drosophila_2:1624641_at:354:457; Interrogation_Position=800; Antisense; GATATCCTGAATTCGTAATTTTCTA
>probe:Drosophila_2:1624641_at:280:327; Interrogation_Position=890; Antisense; TCAGGTCTAACTATGCCCGATTTAC

Paste this into a BLAST search page for me
GACTCTATCTGGAGGCCGACAGATCGAGGCCGACAGATCTGTCAACGACAATTAAGCGAGTTGCGGGAAATCCTGGAAATCCTGACGAAGTCGGCGATGTTATGAGTAGGAACATTTTATGCCCCAGTCATCTACATACCTAGGAGCTATTGAGTACAGCAAACCCGCCCATCAACAAGTCCTATAAGCCGAATCCTGGCGAATCCTGGCAAACGGACATAGATTGATTATCAAATCCACGCTGGGAGCAGAAAAATACGCACTTGCGCTAGCAAGCGCTAGCAATTTCCACAACCAATAGATATCCTGAATTCGTAATTTTCTATCAGGTCTAACTATGCCCGATTTAC

Full Affymetrix probeset data:

Annotations for 1624641_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720