FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624642_at:

>probe:Drosophila_2:1624642_at:669:679; Interrogation_Position=351; Antisense; TAGGACCTTTCAACATCGCTTTTAC
>probe:Drosophila_2:1624642_at:14:343; Interrogation_Position=368; Antisense; GCTTTTACGATCCAAACACGCATGC
>probe:Drosophila_2:1624642_at:485:457; Interrogation_Position=397; Antisense; GATATAGCCCTACTGCGACTGGTGT
>probe:Drosophila_2:1624642_at:679:173; Interrogation_Position=436; Antisense; AAAGCGAACATCAGGCCTATTTGCA
>probe:Drosophila_2:1624642_at:47:587; Interrogation_Position=569; Antisense; TGGACATTTCGCGACAGCCTTCAAA
>probe:Drosophila_2:1624642_at:30:569; Interrogation_Position=607; Antisense; GGCAGCGTTTTGAGCAATCAGTTTT
>probe:Drosophila_2:1624642_at:489:263; Interrogation_Position=648; Antisense; CAGCAATCTTTGCATCGGCGATACT
>probe:Drosophila_2:1624642_at:495:631; Interrogation_Position=678; Antisense; TCCTGTGGGAGCAATGGTTCGATAT
>probe:Drosophila_2:1624642_at:103:677; Interrogation_Position=702; Antisense; TAGAAATGCATTCCGCTTTGTTCAA
>probe:Drosophila_2:1624642_at:654:341; Interrogation_Position=716; Antisense; GCTTTGTTCAAGTAGGTATCGCCAT
>probe:Drosophila_2:1624642_at:332:515; Interrogation_Position=767; Antisense; GTGTATTCACTGATGTCATGAGCCA
>probe:Drosophila_2:1624642_at:504:53; Interrogation_Position=784; Antisense; ATGAGCCATATCGAATTTATCCGTC
>probe:Drosophila_2:1624642_at:563:453; Interrogation_Position=835; Antisense; GATAGGAACCAACCGACACCAAAGC
>probe:Drosophila_2:1624642_at:603:365; Interrogation_Position=885; Antisense; GAATAATCCTTATCCTATACTCTGG

Paste this into a BLAST search page for me
TAGGACCTTTCAACATCGCTTTTACGCTTTTACGATCCAAACACGCATGCGATATAGCCCTACTGCGACTGGTGTAAAGCGAACATCAGGCCTATTTGCATGGACATTTCGCGACAGCCTTCAAAGGCAGCGTTTTGAGCAATCAGTTTTCAGCAATCTTTGCATCGGCGATACTTCCTGTGGGAGCAATGGTTCGATATTAGAAATGCATTCCGCTTTGTTCAAGCTTTGTTCAAGTAGGTATCGCCATGTGTATTCACTGATGTCATGAGCCAATGAGCCATATCGAATTTATCCGTCGATAGGAACCAACCGACACCAAAGCGAATAATCCTTATCCTATACTCTGG

Full Affymetrix probeset data:

Annotations for 1624642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720