Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624643_a_at:

>probe:Drosophila_2:1624643_a_at:414:451; Interrogation_Position=1014; Antisense; GATCAGGAAACTTCACACCGTGGGA
>probe:Drosophila_2:1624643_a_at:702:123; Interrogation_Position=1030; Antisense; ACCGTGGGACCGAAGCACAAGTCTA
>probe:Drosophila_2:1624643_a_at:166:211; Interrogation_Position=1060; Antisense; AAGAAGCGCTCTCACAGGAAGGTCA
>probe:Drosophila_2:1624643_a_at:647:379; Interrogation_Position=779; Antisense; GAACGCCCTTTGTATCCAAGTTGGT
>probe:Drosophila_2:1624643_a_at:391:683; Interrogation_Position=791; Antisense; TATCCAAGTTGGTTTCGGCCTTCGC
>probe:Drosophila_2:1624643_a_at:303:445; Interrogation_Position=819; Antisense; GATGACATCCGTGCTGCTGATGCTG
>probe:Drosophila_2:1624643_a_at:132:51; Interrogation_Position=838; Antisense; ATGCTGCCGGTTATCCTTTTTGCCA
>probe:Drosophila_2:1624643_a_at:125:701; Interrogation_Position=854; Antisense; TTTTTGCCAGCACCGTGCAGTCGAG
>probe:Drosophila_2:1624643_a_at:649:565; Interrogation_Position=883; Antisense; GGCAATGTGTCCTGCAACATCGAGT
>probe:Drosophila_2:1624643_a_at:435:83; Interrogation_Position=905; Antisense; AGTGGCCAGACACTCAGAACTCGCA
>probe:Drosophila_2:1624643_a_at:155:629; Interrogation_Position=937; Antisense; TCCACCTTCATTTTGTACTCGCTGG
>probe:Drosophila_2:1624643_a_at:626:669; Interrogation_Position=952; Antisense; TACTCGCTGGTCTTGGGATTCGCCA
>probe:Drosophila_2:1624643_a_at:564:143; Interrogation_Position=976; Antisense; ACTCCACTGACTTTTATCCTGGTGT
>probe:Drosophila_2:1624643_a_at:569:47; Interrogation_Position=991; Antisense; ATCCTGGTGTTCTACTGCCTGGTGA

Paste this into a BLAST search page for me
GATCAGGAAACTTCACACCGTGGGAACCGTGGGACCGAAGCACAAGTCTAAAGAAGCGCTCTCACAGGAAGGTCAGAACGCCCTTTGTATCCAAGTTGGTTATCCAAGTTGGTTTCGGCCTTCGCGATGACATCCGTGCTGCTGATGCTGATGCTGCCGGTTATCCTTTTTGCCATTTTTGCCAGCACCGTGCAGTCGAGGGCAATGTGTCCTGCAACATCGAGTAGTGGCCAGACACTCAGAACTCGCATCCACCTTCATTTTGTACTCGCTGGTACTCGCTGGTCTTGGGATTCGCCAACTCCACTGACTTTTATCCTGGTGTATCCTGGTGTTCTACTGCCTGGTGA

Full Affymetrix probeset data:

Annotations for 1624643_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime