FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624647_at:

>probe:Drosophila_2:1624647_at:137:295; Interrogation_Position=108; Antisense; CGATGTCCACTACCAATCATACGAT
>probe:Drosophila_2:1624647_at:28:713; Interrogation_Position=13; Antisense; TTCATGCTCGTGAGTAACGGCAGGA
>probe:Drosophila_2:1624647_at:206:543; Interrogation_Position=145; Antisense; GGATTCGATTCCAGCAGTCTGCACA
>probe:Drosophila_2:1624647_at:297:115; Interrogation_Position=157; Antisense; AGCAGTCTGCACATATTCAACGGAA
>probe:Drosophila_2:1624647_at:268:685; Interrogation_Position=170; Antisense; TATTCAACGGAATCGAGCGGGCCGC
>probe:Drosophila_2:1624647_at:225:637; Interrogation_Position=206; Antisense; TCGATGGTATTTTTCAGGGCACTAT
>probe:Drosophila_2:1624647_at:403:81; Interrogation_Position=248; Antisense; AGGGCGATCACGTCGAGGTCACGTA
>probe:Drosophila_2:1624647_at:619:79; Interrogation_Position=263; Antisense; AGGTCACGTACGACGCTGGTGAGAA
>probe:Drosophila_2:1624647_at:319:423; Interrogation_Position=283; Antisense; GAGAACGGATACCAGGCTTCGATCA
>probe:Drosophila_2:1624647_at:400:343; Interrogation_Position=298; Antisense; GCTTCGATCAGCCTTGATTCCGACT
>probe:Drosophila_2:1624647_at:477:265; Interrogation_Position=30; Antisense; CGGCAGGATACGAACTTTTTGGATT
>probe:Drosophila_2:1624647_at:524:261; Interrogation_Position=411; Antisense; CACCGACTTTCCATCGACATGTTAT
>probe:Drosophila_2:1624647_at:671:697; Interrogation_Position=45; Antisense; TTTTTGGATTGAGTGGCTCATCCCC
>probe:Drosophila_2:1624647_at:453:579; Interrogation_Position=79; Antisense; TCCGTAGGACGTTTCGAAAGTGACA

Paste this into a BLAST search page for me
CGATGTCCACTACCAATCATACGATTTCATGCTCGTGAGTAACGGCAGGAGGATTCGATTCCAGCAGTCTGCACAAGCAGTCTGCACATATTCAACGGAATATTCAACGGAATCGAGCGGGCCGCTCGATGGTATTTTTCAGGGCACTATAGGGCGATCACGTCGAGGTCACGTAAGGTCACGTACGACGCTGGTGAGAAGAGAACGGATACCAGGCTTCGATCAGCTTCGATCAGCCTTGATTCCGACTCGGCAGGATACGAACTTTTTGGATTCACCGACTTTCCATCGACATGTTATTTTTTGGATTGAGTGGCTCATCCCCTCCGTAGGACGTTTCGAAAGTGACA

Full Affymetrix probeset data:

Annotations for 1624647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720