Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624650_at:

>probe:Drosophila_2:1624650_at:520:643; Interrogation_Position=13856; Antisense; TCTCCCATGCTCGATTGACGGACAA
>probe:Drosophila_2:1624650_at:389:427; Interrogation_Position=13885; Antisense; GAGATTATGCTCACCAATGCCATGT
>probe:Drosophila_2:1624650_at:573:545; Interrogation_Position=13917; Antisense; GGATGCAGATGAGGCGCCAACATTC
>probe:Drosophila_2:1624650_at:681:491; Interrogation_Position=13961; Antisense; GTAACTTTGCGAATCCGGTGTACGA
>probe:Drosophila_2:1624650_at:9:137; Interrogation_Position=13982; Antisense; ACGAATCCATGTACGCGGATGCCAT
>probe:Drosophila_2:1624650_at:416:611; Interrogation_Position=14025; Antisense; TGAAATAACACACAGCACGGCTCCG
>probe:Drosophila_2:1624650_at:536:393; Interrogation_Position=14057; Antisense; GAAAGGGTCTGCTGCAGCACACGCA
>probe:Drosophila_2:1624650_at:730:133; Interrogation_Position=14095; Antisense; ACGCCGGACATCCTCTGATGATTGA
>probe:Drosophila_2:1624650_at:493:59; Interrogation_Position=14112; Antisense; ATGATTGACCCGCTGCAACCGAGAG
>probe:Drosophila_2:1624650_at:399:489; Interrogation_Position=14154; Antisense; GTACATGGAGACATCCACATCCCAA
>probe:Drosophila_2:1624650_at:151:285; Interrogation_Position=14307; Antisense; CTGAGCCCTCATCCAAAGAGCTATA
>probe:Drosophila_2:1624650_at:156:213; Interrogation_Position=14322; Antisense; AAGAGCTATAACTCGGGCAGCCTTG
>probe:Drosophila_2:1624650_at:133:679; Interrogation_Position=14357; Antisense; TATGTCCCTAACGATGTCCTTATAC
>probe:Drosophila_2:1624650_at:272:157; Interrogation_Position=14394; Antisense; ACACGTTTTACAAGCGCCTTTTGAT

Paste this into a BLAST search page for me
TCTCCCATGCTCGATTGACGGACAAGAGATTATGCTCACCAATGCCATGTGGATGCAGATGAGGCGCCAACATTCGTAACTTTGCGAATCCGGTGTACGAACGAATCCATGTACGCGGATGCCATTGAAATAACACACAGCACGGCTCCGGAAAGGGTCTGCTGCAGCACACGCAACGCCGGACATCCTCTGATGATTGAATGATTGACCCGCTGCAACCGAGAGGTACATGGAGACATCCACATCCCAACTGAGCCCTCATCCAAAGAGCTATAAAGAGCTATAACTCGGGCAGCCTTGTATGTCCCTAACGATGTCCTTATACACACGTTTTACAAGCGCCTTTTGAT

Full Affymetrix probeset data:

Annotations for 1624650_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime