FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624653_at:

>probe:Drosophila_2:1624653_at:61:615; Interrogation_Position=128; Antisense; TGAAGGCGGTCATGTTTCCAGGCCT
>probe:Drosophila_2:1624653_at:555:323; Interrogation_Position=195; Antisense; GCGCGCTTTGACAATGGTTGCCTAC
>probe:Drosophila_2:1624653_at:563:541; Interrogation_Position=210; Antisense; GGTTGCCTACATTTTGAACGCTGTT
>probe:Drosophila_2:1624653_at:692:381; Interrogation_Position=225; Antisense; GAACGCTGTTCTTGGGATTCACATG
>probe:Drosophila_2:1624653_at:158:489; Interrogation_Position=273; Antisense; GTACGCTGGCTATATGCTCGTTGGA
>probe:Drosophila_2:1624653_at:504:611; Interrogation_Position=332; Antisense; TGACTCGCTTCATGTACCGCAAAAG
>probe:Drosophila_2:1624653_at:427:93; Interrogation_Position=362; Antisense; AGTTCTTTGCCGAGATGCTGGTGCT
>probe:Drosophila_2:1624653_at:112:487; Interrogation_Position=454; Antisense; GTAGTTGACTACCAGACAGCATCGA
>probe:Drosophila_2:1624653_at:392:377; Interrogation_Position=540; Antisense; GAAGCTTAGCCAGTACCTGTGGACT
>probe:Drosophila_2:1624653_at:70:243; Interrogation_Position=589; Antisense; AATATTATCGTATCCGTTCTCTTGT
>probe:Drosophila_2:1624653_at:281:293; Interrogation_Position=603; Antisense; CGTTCTCTTGTTTGTGGCGATGATC
>probe:Drosophila_2:1624653_at:461:443; Interrogation_Position=621; Antisense; GATGATCGTCATGGTTTTACACTTT
>probe:Drosophila_2:1624653_at:165:443; Interrogation_Position=649; Antisense; GATGTGCAATCGCTCGACGACACTA
>probe:Drosophila_2:1624653_at:720:195; Interrogation_Position=695; Antisense; AACTGGTAGACGACTCGGACGCCAA

Paste this into a BLAST search page for me
TGAAGGCGGTCATGTTTCCAGGCCTGCGCGCTTTGACAATGGTTGCCTACGGTTGCCTACATTTTGAACGCTGTTGAACGCTGTTCTTGGGATTCACATGGTACGCTGGCTATATGCTCGTTGGATGACTCGCTTCATGTACCGCAAAAGAGTTCTTTGCCGAGATGCTGGTGCTGTAGTTGACTACCAGACAGCATCGAGAAGCTTAGCCAGTACCTGTGGACTAATATTATCGTATCCGTTCTCTTGTCGTTCTCTTGTTTGTGGCGATGATCGATGATCGTCATGGTTTTACACTTTGATGTGCAATCGCTCGACGACACTAAACTGGTAGACGACTCGGACGCCAA

Full Affymetrix probeset data:

Annotations for 1624653_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720