FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624654_at:

>probe:Drosophila_2:1624654_at:492:43; Interrogation_Position=17; Antisense; ATCGCTCAAAGCTGCAGAACGTCGG
>probe:Drosophila_2:1624654_at:369:171; Interrogation_Position=175; Antisense; AAAGTCTTCATGGACATGGGCTTCC
>probe:Drosophila_2:1624654_at:306:593; Interrogation_Position=191; Antisense; TGGGCTTCCAGATGAATTACAACCT
>probe:Drosophila_2:1624654_at:367:665; Interrogation_Position=238; Antisense; TACAATGCCACCATCTGGGCAGATG
>probe:Drosophila_2:1624654_at:259:351; Interrogation_Position=256; Antisense; GCAGATGAGCTGTCCCGAAGGCAAA
>probe:Drosophila_2:1624654_at:271:95; Interrogation_Position=287; Antisense; AGTTGGACCACAGCCTGGATGCTAA
>probe:Drosophila_2:1624654_at:714:105; Interrogation_Position=32; Antisense; AGAACGTCGGAGATCTCGGCCAGGT
>probe:Drosophila_2:1624654_at:425:53; Interrogation_Position=340; Antisense; ATGCATCCCGCTGATTTTACAGCCG
>probe:Drosophila_2:1624654_at:440:153; Interrogation_Position=389; Antisense; ACATGCTCGAGACCTATGGTTTCCA
>probe:Drosophila_2:1624654_at:207:65; Interrogation_Position=404; Antisense; ATGGTTTCCATAGATCCTGTCTGCT
>probe:Drosophila_2:1624654_at:729:695; Interrogation_Position=459; Antisense; TTTCGCTGAGGACCACTTCTATGGA
>probe:Drosophila_2:1624654_at:593:215; Interrogation_Position=494; Antisense; AAGTTATAACCTTCCTGCTCACGTA
>probe:Drosophila_2:1624654_at:416:133; Interrogation_Position=73; Antisense; ACCCTGATACGACCCATTTATGGAC
>probe:Drosophila_2:1624654_at:350:699; Interrogation_Position=89; Antisense; TTTATGGACTTCTGCTTTTTCCCAC

Paste this into a BLAST search page for me
ATCGCTCAAAGCTGCAGAACGTCGGAAAGTCTTCATGGACATGGGCTTCCTGGGCTTCCAGATGAATTACAACCTTACAATGCCACCATCTGGGCAGATGGCAGATGAGCTGTCCCGAAGGCAAAAGTTGGACCACAGCCTGGATGCTAAAGAACGTCGGAGATCTCGGCCAGGTATGCATCCCGCTGATTTTACAGCCGACATGCTCGAGACCTATGGTTTCCAATGGTTTCCATAGATCCTGTCTGCTTTTCGCTGAGGACCACTTCTATGGAAAGTTATAACCTTCCTGCTCACGTAACCCTGATACGACCCATTTATGGACTTTATGGACTTCTGCTTTTTCCCAC

Full Affymetrix probeset data:

Annotations for 1624654_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720