FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624655_at:

>probe:Drosophila_2:1624655_at:393:721; Interrogation_Position=1061; Antisense; TTGCCTACAAATTGCCACCTAATGC
>probe:Drosophila_2:1624655_at:597:123; Interrogation_Position=1094; Antisense; AGCCATCTGTCAGTCGGTGGGCCAA
>probe:Drosophila_2:1624655_at:78:275; Interrogation_Position=1173; Antisense; CATTGACAGGTTCTCACTGACGTGA
>probe:Drosophila_2:1624655_at:669:641; Interrogation_Position=603; Antisense; TCTACCGCTTTTCGAGGGCAACAGC
>probe:Drosophila_2:1624655_at:544:331; Interrogation_Position=638; Antisense; GCTTGAGTCCCAGTGACGCTAGGTT
>probe:Drosophila_2:1624655_at:488:133; Interrogation_Position=653; Antisense; ACGCTAGGTTCGTGGATGTCATCCA
>probe:Drosophila_2:1624655_at:460:537; Interrogation_Position=715; Antisense; GGTCATGCAGACTTCTATCCGAATG
>probe:Drosophila_2:1624655_at:481:617; Interrogation_Position=752; Antisense; TGCAGCCGGGTTGTGCCAAACAGAA
>probe:Drosophila_2:1624655_at:491:525; Interrogation_Position=795; Antisense; GGGAATCATTGTTGGCTGCAGTCAC
>probe:Drosophila_2:1624655_at:634:121; Interrogation_Position=821; Antisense; AGCGTGCCTGGGAATACTTCGTGGA
>probe:Drosophila_2:1624655_at:557:425; Interrogation_Position=844; Antisense; GAGAGCATAGCCCAGCCTCGAGGAT
>probe:Drosophila_2:1624655_at:139:417; Interrogation_Position=886; Antisense; GAGCCCTCCGATATGTTCGGCATTT
>probe:Drosophila_2:1624655_at:364:287; Interrogation_Position=903; Antisense; CGGCATTTGCCGTGAACCAGGAGGT
>probe:Drosophila_2:1624655_at:75:575; Interrogation_Position=951; Antisense; GGCGGATCCCAGGATTCGTGGCAAA

Paste this into a BLAST search page for me
TTGCCTACAAATTGCCACCTAATGCAGCCATCTGTCAGTCGGTGGGCCAACATTGACAGGTTCTCACTGACGTGATCTACCGCTTTTCGAGGGCAACAGCGCTTGAGTCCCAGTGACGCTAGGTTACGCTAGGTTCGTGGATGTCATCCAGGTCATGCAGACTTCTATCCGAATGTGCAGCCGGGTTGTGCCAAACAGAAGGGAATCATTGTTGGCTGCAGTCACAGCGTGCCTGGGAATACTTCGTGGAGAGAGCATAGCCCAGCCTCGAGGATGAGCCCTCCGATATGTTCGGCATTTCGGCATTTGCCGTGAACCAGGAGGTGGCGGATCCCAGGATTCGTGGCAAA

Full Affymetrix probeset data:

Annotations for 1624655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720