FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624658_at:

>probe:Drosophila_2:1624658_at:462:71; Interrogation_Position=2663; Antisense; AGGCTTTCCAGAATCAGCCACAAAG
>probe:Drosophila_2:1624658_at:251:539; Interrogation_Position=2691; Antisense; GGTAACTCCCATGTATAGCTGCAAT
>probe:Drosophila_2:1624658_at:585:333; Interrogation_Position=2708; Antisense; GCTGCAATATTGTGGTCAACGCCGA
>probe:Drosophila_2:1624658_at:443:565; Interrogation_Position=2773; Antisense; GGCAAAATCCTCTCCGGCGATTTGA
>probe:Drosophila_2:1624658_at:241:621; Interrogation_Position=2831; Antisense; TGCTGCCGGTGATCGAGTCGTTCAA
>probe:Drosophila_2:1624658_at:699:87; Interrogation_Position=2846; Antisense; AGTCGTTCAATTTCGCCCAGGAGAT
>probe:Drosophila_2:1624658_at:178:173; Interrogation_Position=2874; Antisense; AAAGCAGACATCTGGCCTGGCCTGT
>probe:Drosophila_2:1624658_at:68:157; Interrogation_Position=2901; Antisense; ACAGCTCATGTTCAGCCACTGGGAG
>probe:Drosophila_2:1624658_at:182:605; Interrogation_Position=2927; Antisense; TGATTGATATCGATCCCTTCTGGCT
>probe:Drosophila_2:1624658_at:249:715; Interrogation_Position=2944; Antisense; TTCTGGCTGCCGACAACCGAGGAGG
>probe:Drosophila_2:1624658_at:126:123; Interrogation_Position=3089; Antisense; AGCGCACCCTGTCCAAGAACAAGTG
>probe:Drosophila_2:1624658_at:486:221; Interrogation_Position=3109; Antisense; AAGTGATTTGGCACTTGACCGCTCG
>probe:Drosophila_2:1624658_at:194:611; Interrogation_Position=3124; Antisense; TGACCGCTCGGTTACCAAGAAGTTT
>probe:Drosophila_2:1624658_at:82:693; Interrogation_Position=3148; Antisense; TTTGATTTACCTTGGATGCCGGAAA

Paste this into a BLAST search page for me
AGGCTTTCCAGAATCAGCCACAAAGGGTAACTCCCATGTATAGCTGCAATGCTGCAATATTGTGGTCAACGCCGAGGCAAAATCCTCTCCGGCGATTTGATGCTGCCGGTGATCGAGTCGTTCAAAGTCGTTCAATTTCGCCCAGGAGATAAAGCAGACATCTGGCCTGGCCTGTACAGCTCATGTTCAGCCACTGGGAGTGATTGATATCGATCCCTTCTGGCTTTCTGGCTGCCGACAACCGAGGAGGAGCGCACCCTGTCCAAGAACAAGTGAAGTGATTTGGCACTTGACCGCTCGTGACCGCTCGGTTACCAAGAAGTTTTTTGATTTACCTTGGATGCCGGAAA

Full Affymetrix probeset data:

Annotations for 1624658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720