FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624659_at:

>probe:Drosophila_2:1624659_at:533:323; Interrogation_Position=1558; Antisense; GCGCTGCATTCTTCATCAGTCTTAG
>probe:Drosophila_2:1624659_at:227:649; Interrogation_Position=1573; Antisense; TCAGTCTTAGGGTTCTTTGTACTTC
>probe:Drosophila_2:1624659_at:693:727; Interrogation_Position=1589; Antisense; TTGTACTTCCGTTTCGTTCTGGCGT
>probe:Drosophila_2:1624659_at:561:11; Interrogation_Position=1634; Antisense; ATTCTTGGCCAAACGCACGCGGTAC
>probe:Drosophila_2:1624659_at:67:289; Interrogation_Position=1725; Antisense; CTGGCCTCAATCGATTCTTGTTGTA
>probe:Drosophila_2:1624659_at:426:699; Interrogation_Position=1742; Antisense; TTGTTGTACTCTAAGAGGCCCCGAT
>probe:Drosophila_2:1624659_at:676:99; Interrogation_Position=1755; Antisense; AGAGGCCCCGATTGCCCGAGTAGAG
>probe:Drosophila_2:1624659_at:64:569; Interrogation_Position=1780; Antisense; GGCATGGTGCATGGGACTCTCATAG
>probe:Drosophila_2:1624659_at:712:271; Interrogation_Position=1800; Antisense; CATAGCTGAGATACTCCGGCTTGAT
>probe:Drosophila_2:1624659_at:313:519; Interrogation_Position=1885; Antisense; GTGGTGCTCGGTGGTAATGCTCCCT
>probe:Drosophila_2:1624659_at:623:145; Interrogation_Position=1958; Antisense; ACTCGCCTTTGGGATCCGGTTGGTG
>probe:Drosophila_2:1624659_at:222:369; Interrogation_Position=2009; Antisense; GAAGTTATGTCCTTCCGTGGTTCCA
>probe:Drosophila_2:1624659_at:456:303; Interrogation_Position=2064; Antisense; CCGCGCGCCGGGAATTAACACAATT
>probe:Drosophila_2:1624659_at:285:187; Interrogation_Position=2080; Antisense; AACACAATTAACTGGCCTGGGCAAA

Paste this into a BLAST search page for me
GCGCTGCATTCTTCATCAGTCTTAGTCAGTCTTAGGGTTCTTTGTACTTCTTGTACTTCCGTTTCGTTCTGGCGTATTCTTGGCCAAACGCACGCGGTACCTGGCCTCAATCGATTCTTGTTGTATTGTTGTACTCTAAGAGGCCCCGATAGAGGCCCCGATTGCCCGAGTAGAGGGCATGGTGCATGGGACTCTCATAGCATAGCTGAGATACTCCGGCTTGATGTGGTGCTCGGTGGTAATGCTCCCTACTCGCCTTTGGGATCCGGTTGGTGGAAGTTATGTCCTTCCGTGGTTCCACCGCGCGCCGGGAATTAACACAATTAACACAATTAACTGGCCTGGGCAAA

Full Affymetrix probeset data:

Annotations for 1624659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720