Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624660_at:

>probe:Drosophila_2:1624660_at:655:381; Interrogation_Position=6630; Antisense; GAACGAACACGCATCAATTTATACA
>probe:Drosophila_2:1624660_at:397:367; Interrogation_Position=6696; Antisense; GAATCGGCGTACAATGTAACCGCAA
>probe:Drosophila_2:1624660_at:194:59; Interrogation_Position=6709; Antisense; ATGTAACCGCAATTGCCGCTTCAAA
>probe:Drosophila_2:1624660_at:58:253; Interrogation_Position=6730; Antisense; CAAACCGACGGCAATACTAAATACT
>probe:Drosophila_2:1624660_at:556:141; Interrogation_Position=6760; Antisense; ACTGATTGTATTTTTACGCTAGCCA
>probe:Drosophila_2:1624660_at:325:17; Interrogation_Position=6769; Antisense; ATTTTTACGCTAGCCACAATTTGAT
>probe:Drosophila_2:1624660_at:107:695; Interrogation_Position=6815; Antisense; TTTTTTGTACACCTAATGTTAGTTG
>probe:Drosophila_2:1624660_at:417:509; Interrogation_Position=6846; Antisense; GTGAGCGAGACGAGCAAATTTTTGT
>probe:Drosophila_2:1624660_at:264:279; Interrogation_Position=6963; Antisense; CTAACTATAAATCGCACACACTCAT
>probe:Drosophila_2:1624660_at:580:179; Interrogation_Position=7045; Antisense; AAACATTTTGCTGCAACCGTCGGAG
>probe:Drosophila_2:1624660_at:245:253; Interrogation_Position=7058; Antisense; CAACCGTCGGAGATGTAGTGTACAA
>probe:Drosophila_2:1624660_at:276:513; Interrogation_Position=7075; Antisense; GTGTACAATTTTTAGTTTCTCGTAT
>probe:Drosophila_2:1624660_at:612:327; Interrogation_Position=7154; Antisense; GCGTAAACTGTGTATGTATGTGCTA
>probe:Drosophila_2:1624660_at:302:485; Interrogation_Position=7169; Antisense; GTATGTGCTACATTGATTTTTGTTT

Paste this into a BLAST search page for me
GAACGAACACGCATCAATTTATACAGAATCGGCGTACAATGTAACCGCAAATGTAACCGCAATTGCCGCTTCAAACAAACCGACGGCAATACTAAATACTACTGATTGTATTTTTACGCTAGCCAATTTTTACGCTAGCCACAATTTGATTTTTTTGTACACCTAATGTTAGTTGGTGAGCGAGACGAGCAAATTTTTGTCTAACTATAAATCGCACACACTCATAAACATTTTGCTGCAACCGTCGGAGCAACCGTCGGAGATGTAGTGTACAAGTGTACAATTTTTAGTTTCTCGTATGCGTAAACTGTGTATGTATGTGCTAGTATGTGCTACATTGATTTTTGTTT

Full Affymetrix probeset data:

Annotations for 1624660_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime