Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624662_at:

>probe:Drosophila_2:1624662_at:416:197; Interrogation_Position=1869; Antisense; AACGTCGTGGGCTCTGTCCATTGGT
>probe:Drosophila_2:1624662_at:266:629; Interrogation_Position=1885; Antisense; TCCATTGGTTGGATCGTTTGGGCCT
>probe:Drosophila_2:1624662_at:201:481; Interrogation_Position=1900; Antisense; GTTTGGGCCTGCTACAATGGTCACG
>probe:Drosophila_2:1624662_at:381:65; Interrogation_Position=1916; Antisense; ATGGTCACGGCGGTCTGGTCAATGA
>probe:Drosophila_2:1624662_at:337:287; Interrogation_Position=1930; Antisense; CTGGTCAATGACTTCTTGTCCTGGG
>probe:Drosophila_2:1624662_at:110:343; Interrogation_Position=1967; Antisense; GCTTCAGCCGACTGTGTTACTGTAT
>probe:Drosophila_2:1624662_at:362:601; Interrogation_Position=1991; Antisense; TGTACGTCATTCATCGCATTGTCCA
>probe:Drosophila_2:1624662_at:602:297; Interrogation_Position=2077; Antisense; CGCTGGTGGCATGACTTTGGCATCA
>probe:Drosophila_2:1624662_at:727:565; Interrogation_Position=2139; Antisense; GGCACCCATTTTGGGCATCGAGAAG
>probe:Drosophila_2:1624662_at:685:109; Interrogation_Position=2159; Antisense; AGAAGGCCATATTCGGCAAGCCGGC
>probe:Drosophila_2:1624662_at:167:211; Interrogation_Position=2188; Antisense; AAGAAGCCATCTCCCGGAGAGCTGG
>probe:Drosophila_2:1624662_at:43:379; Interrogation_Position=2263; Antisense; GAAGCCAAACCCGAGTCCGTTGTGG
>probe:Drosophila_2:1624662_at:586:101; Interrogation_Position=2325; Antisense; AGAGAATCCATCCAAGGCCTAGACT
>probe:Drosophila_2:1624662_at:71:105; Interrogation_Position=2345; Antisense; AGACTCTGCAGCCTTAGCACGATTT

Paste this into a BLAST search page for me
AACGTCGTGGGCTCTGTCCATTGGTTCCATTGGTTGGATCGTTTGGGCCTGTTTGGGCCTGCTACAATGGTCACGATGGTCACGGCGGTCTGGTCAATGACTGGTCAATGACTTCTTGTCCTGGGGCTTCAGCCGACTGTGTTACTGTATTGTACGTCATTCATCGCATTGTCCACGCTGGTGGCATGACTTTGGCATCAGGCACCCATTTTGGGCATCGAGAAGAGAAGGCCATATTCGGCAAGCCGGCAAGAAGCCATCTCCCGGAGAGCTGGGAAGCCAAACCCGAGTCCGTTGTGGAGAGAATCCATCCAAGGCCTAGACTAGACTCTGCAGCCTTAGCACGATTT

Full Affymetrix probeset data:

Annotations for 1624662_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime