FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624664_at:

>probe:Drosophila_2:1624664_at:412:469; Interrogation_Position=1045; Antisense; GTTCCTGGGCGCCAAATCGAATGCC
>probe:Drosophila_2:1624664_at:134:557; Interrogation_Position=1087; Antisense; GGACGTAGTCCCACAAATGACCTGC
>probe:Drosophila_2:1624664_at:269:413; Interrogation_Position=1105; Antisense; GACCTGCAAGCAGATCTATCGCAAG
>probe:Drosophila_2:1624664_at:493:715; Interrogation_Position=1166; Antisense; TTCTGTGCGGGATATTTGCCAGGCG
>probe:Drosophila_2:1624664_at:703:625; Interrogation_Position=1239; Antisense; TGCCGGAATACAACTGCGTGGCCTT
>probe:Drosophila_2:1624664_at:86:519; Interrogation_Position=1268; Antisense; GTGGGCATCACCTCGTTTGGAAAAT
>probe:Drosophila_2:1624664_at:584:297; Interrogation_Position=1312; Antisense; CCCAGGAGTTTACACCAGGCTATAT
>probe:Drosophila_2:1624664_at:590:463; Interrogation_Position=1360; Antisense; GATTGCCTTCAAGCAGCACTAGTTT
>probe:Drosophila_2:1624664_at:360:91; Interrogation_Position=831; Antisense; AGTTGAACGAGACCAGCGCGACCCA
>probe:Drosophila_2:1624664_at:355:213; Interrogation_Position=866; Antisense; AAGATCCTCATCATCGTGCTGCATC
>probe:Drosophila_2:1624664_at:579:619; Interrogation_Position=882; Antisense; TGCTGCATCCGAAGTACAGATCCTC
>probe:Drosophila_2:1624664_at:417:449; Interrogation_Position=900; Antisense; GATCCTCGGCATATTACCACGATAT
>probe:Drosophila_2:1624664_at:592:7; Interrogation_Position=923; Antisense; ATTGCCCTGCTCAAGCTGACCAGAA
>probe:Drosophila_2:1624664_at:457:417; Interrogation_Position=998; Antisense; GAGCTCCAGATACCCACTGTGGTGG

Paste this into a BLAST search page for me
GTTCCTGGGCGCCAAATCGAATGCCGGACGTAGTCCCACAAATGACCTGCGACCTGCAAGCAGATCTATCGCAAGTTCTGTGCGGGATATTTGCCAGGCGTGCCGGAATACAACTGCGTGGCCTTGTGGGCATCACCTCGTTTGGAAAATCCCAGGAGTTTACACCAGGCTATATGATTGCCTTCAAGCAGCACTAGTTTAGTTGAACGAGACCAGCGCGACCCAAAGATCCTCATCATCGTGCTGCATCTGCTGCATCCGAAGTACAGATCCTCGATCCTCGGCATATTACCACGATATATTGCCCTGCTCAAGCTGACCAGAAGAGCTCCAGATACCCACTGTGGTGG

Full Affymetrix probeset data:

Annotations for 1624664_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720