Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624666_at:

>probe:Drosophila_2:1624666_at:363:125; Interrogation_Position=1358; Antisense; AGCCGTCCTGGTCAATGTCCTTAAG
>probe:Drosophila_2:1624666_at:338:427; Interrogation_Position=1396; Antisense; GAGATCACGAGTTCAGCTGGCAGCA
>probe:Drosophila_2:1624666_at:179:333; Interrogation_Position=1411; Antisense; GCTGGCAGCAGGCACTCCAAGTAAA
>probe:Drosophila_2:1624666_at:241:587; Interrogation_Position=1513; Antisense; TGGACGACATTAAGCCCGACTGGAA
>probe:Drosophila_2:1624666_at:258:585; Interrogation_Position=1533; Antisense; TGGAAGCATTTCTCTACGGAGCCTG
>probe:Drosophila_2:1624666_at:54:547; Interrogation_Position=1559; Antisense; GGATGCTTTGGATCTGCTCTACGCA
>probe:Drosophila_2:1624666_at:392:355; Interrogation_Position=1581; Antisense; GCACTGGCACGTTTCGATCAAAGCG
>probe:Drosophila_2:1624666_at:132:197; Interrogation_Position=1624; Antisense; AACTGGAGGCTTGTGTCCTTGTCAA
>probe:Drosophila_2:1624666_at:159:505; Interrogation_Position=1638; Antisense; GTCCTTGTCAACTATCTCTTTGGAT
>probe:Drosophila_2:1624666_at:109:543; Interrogation_Position=1659; Antisense; GGATTGTGCAATGCCACCAGTCAAG
>probe:Drosophila_2:1624666_at:554:343; Interrogation_Position=1742; Antisense; GCTTCTTTTTCACGCTGCCAAAAAA
>probe:Drosophila_2:1624666_at:174:143; Interrogation_Position=1769; Antisense; ACTGCGACACGGAATGGAGCTCCTT
>probe:Drosophila_2:1624666_at:634:303; Interrogation_Position=1796; Antisense; CCTGCGTCCACTGAACCAAATGTAG
>probe:Drosophila_2:1624666_at:165:677; Interrogation_Position=1827; Antisense; TAGACCTAAGGCACCGCAGTTAACA

Paste this into a BLAST search page for me
AGCCGTCCTGGTCAATGTCCTTAAGGAGATCACGAGTTCAGCTGGCAGCAGCTGGCAGCAGGCACTCCAAGTAAATGGACGACATTAAGCCCGACTGGAATGGAAGCATTTCTCTACGGAGCCTGGGATGCTTTGGATCTGCTCTACGCAGCACTGGCACGTTTCGATCAAAGCGAACTGGAGGCTTGTGTCCTTGTCAAGTCCTTGTCAACTATCTCTTTGGATGGATTGTGCAATGCCACCAGTCAAGGCTTCTTTTTCACGCTGCCAAAAAAACTGCGACACGGAATGGAGCTCCTTCCTGCGTCCACTGAACCAAATGTAGTAGACCTAAGGCACCGCAGTTAACA

Full Affymetrix probeset data:

Annotations for 1624666_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime