Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624667_at:

>probe:Drosophila_2:1624667_at:169:191; Interrogation_Position=3867; Antisense; AACTATTTTATTTGTCGAACGCCTG
>probe:Drosophila_2:1624667_at:627:499; Interrogation_Position=3880; Antisense; GTCGAACGCCTGTCTTAATTCACAA
>probe:Drosophila_2:1624667_at:599:243; Interrogation_Position=3903; Antisense; AATTCGAACATTGCCTCTTTTCACT
>probe:Drosophila_2:1624667_at:450:707; Interrogation_Position=3952; Antisense; TTAAACTTTCCAGCCGCATAAACGC
>probe:Drosophila_2:1624667_at:367:199; Interrogation_Position=3972; Antisense; AACGCAAACTTCATGTGTAACCTTT
>probe:Drosophila_2:1624667_at:509:713; Interrogation_Position=4001; Antisense; TTCGCTTTTTAGTCATATCCACCCA
>probe:Drosophila_2:1624667_at:266:271; Interrogation_Position=4040; Antisense; CATCCATGATCTCCATCGTTTTTGA
>probe:Drosophila_2:1624667_at:155:93; Interrogation_Position=4089; Antisense; AGCAAATTTTTCTCACTTCGTTCGG
>probe:Drosophila_2:1624667_at:584:123; Interrogation_Position=4149; Antisense; AGCCAGTTGGTCTGATGGGTCTCAT
>probe:Drosophila_2:1624667_at:357:531; Interrogation_Position=4165; Antisense; GGGTCTCATAGAGTCCATCGGAGCC
>probe:Drosophila_2:1624667_at:138:415; Interrogation_Position=4185; Antisense; GAGCCCCTAGGGACTTGGCATTAAT
>probe:Drosophila_2:1624667_at:169:677; Interrogation_Position=4220; Antisense; TAGCACTCATGCACCTAGCGAAATA
>probe:Drosophila_2:1624667_at:723:247; Interrogation_Position=4245; Antisense; AATTGCATTTTCCTTGTTCTCGTTG
>probe:Drosophila_2:1624667_at:367:471; Interrogation_Position=4260; Antisense; GTTCTCGTTGCACCCATTCATAGGA

Paste this into a BLAST search page for me
AACTATTTTATTTGTCGAACGCCTGGTCGAACGCCTGTCTTAATTCACAAAATTCGAACATTGCCTCTTTTCACTTTAAACTTTCCAGCCGCATAAACGCAACGCAAACTTCATGTGTAACCTTTTTCGCTTTTTAGTCATATCCACCCACATCCATGATCTCCATCGTTTTTGAAGCAAATTTTTCTCACTTCGTTCGGAGCCAGTTGGTCTGATGGGTCTCATGGGTCTCATAGAGTCCATCGGAGCCGAGCCCCTAGGGACTTGGCATTAATTAGCACTCATGCACCTAGCGAAATAAATTGCATTTTCCTTGTTCTCGTTGGTTCTCGTTGCACCCATTCATAGGA

Full Affymetrix probeset data:

Annotations for 1624667_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime