Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624668_s_at:

>probe:Drosophila_2:1624668_s_at:13:431; Interrogation_Position=260; Antisense; GAGTTTGCTCAGGAGGCGCTGAACA
>probe:Drosophila_2:1624668_s_at:204:613; Interrogation_Position=279; Antisense; TGAACAAGGGCGAGCACAGATGCGT
>probe:Drosophila_2:1624668_s_at:133:593; Interrogation_Position=330; Antisense; TGGTGAAGACCATATCCTGTGCCGA
>probe:Drosophila_2:1624668_s_at:419:135; Interrogation_Position=389; Antisense; ACGCGCATGGCCTACACCAGTGTGG
>probe:Drosophila_2:1624668_s_at:328:553; Interrogation_Position=415; Antisense; GGAGCACTGGAAGCCGCAAATGGAA
>probe:Drosophila_2:1624668_s_at:351:437; Interrogation_Position=446; Antisense; GAGGAGATTATAGTCACACGCCAAA
>probe:Drosophila_2:1624668_s_at:400:617; Interrogation_Position=480; Antisense; TGCACATCCTCATGAGTCTGGACGA
>probe:Drosophila_2:1624668_s_at:456:641; Interrogation_Position=496; Antisense; TCTGGACGAGCTGCCGGATACTATA
>probe:Drosophila_2:1624668_s_at:309:157; Interrogation_Position=538; Antisense; AAATACGTCCACTGATTTTTGGGAT
>probe:Drosophila_2:1624668_s_at:415:411; Interrogation_Position=669; Antisense; GACCCGGACGCAATAAACCAGGCCA
>probe:Drosophila_2:1624668_s_at:294:175; Interrogation_Position=704; Antisense; AAACCTGCCGCTGAAGAGAATTTAC
>probe:Drosophila_2:1624668_s_at:660:363; Interrogation_Position=721; Antisense; GAATTTACCCGCCAGTTAGAGTCAA
>probe:Drosophila_2:1624668_s_at:586:657; Interrogation_Position=754; Antisense; TAAGCGGACCATGCGAAGATTTTCT
>probe:Drosophila_2:1624668_s_at:76:375; Interrogation_Position=768; Antisense; GAAGATTTTCTTATTTGCCCTTTGT

Paste this into a BLAST search page for me
GAGTTTGCTCAGGAGGCGCTGAACATGAACAAGGGCGAGCACAGATGCGTTGGTGAAGACCATATCCTGTGCCGAACGCGCATGGCCTACACCAGTGTGGGGAGCACTGGAAGCCGCAAATGGAAGAGGAGATTATAGTCACACGCCAAATGCACATCCTCATGAGTCTGGACGATCTGGACGAGCTGCCGGATACTATAAAATACGTCCACTGATTTTTGGGATGACCCGGACGCAATAAACCAGGCCAAAACCTGCCGCTGAAGAGAATTTACGAATTTACCCGCCAGTTAGAGTCAATAAGCGGACCATGCGAAGATTTTCTGAAGATTTTCTTATTTGCCCTTTGT

Full Affymetrix probeset data:

Annotations for 1624668_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime