FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624669_at:

>probe:Drosophila_2:1624669_at:569:403; Interrogation_Position=458; Antisense; GACTTTGACTCGTACGTTCAGGGCG
>probe:Drosophila_2:1624669_at:374:713; Interrogation_Position=539; Antisense; TTCGTGTCCAAGATCTACCGGGCAG
>probe:Drosophila_2:1624669_at:648:71; Interrogation_Position=566; Antisense; AGGACCAGTCGGTTGTACACTCAGC
>probe:Drosophila_2:1624669_at:331:665; Interrogation_Position=581; Antisense; TACACTCAGCTCAAGCGGTTCTTTA
>probe:Drosophila_2:1624669_at:107:107; Interrogation_Position=606; Antisense; AGAACGTATGCGTGTTCAAGCCCTC
>probe:Drosophila_2:1624669_at:710:359; Interrogation_Position=639; Antisense; GCAACTCCAGCATTGAAGCCTTCGT
>probe:Drosophila_2:1624669_at:128:427; Interrogation_Position=672; Antisense; GAGAGTTTTGTCTGCCCGATGGCTA
>probe:Drosophila_2:1624669_at:217:205; Interrogation_Position=698; Antisense; AAGCCTTGCAACCTGACGACCGAAT
>probe:Drosophila_2:1624669_at:312:369; Interrogation_Position=719; Antisense; GAATGGCACGATCAACCCGAGTCGT
>probe:Drosophila_2:1624669_at:361:705; Interrogation_Position=777; Antisense; TTCAAGTTCCCTTTGTTGCCTACAA
>probe:Drosophila_2:1624669_at:644:427; Interrogation_Position=806; Antisense; GAGTTGGACTCGGATCGCACATACG
>probe:Drosophila_2:1624669_at:590:171; Interrogation_Position=854; Antisense; AAAGAGCCAGTGCAGCAACCCTTGA
>probe:Drosophila_2:1624669_at:296:303; Interrogation_Position=882; Antisense; CCGCCTATCAGGACATTCTGCAGAA
>probe:Drosophila_2:1624669_at:211:371; Interrogation_Position=932; Antisense; GAAGGCATTCGCGTTATTCACGATG

Paste this into a BLAST search page for me
GACTTTGACTCGTACGTTCAGGGCGTTCGTGTCCAAGATCTACCGGGCAGAGGACCAGTCGGTTGTACACTCAGCTACACTCAGCTCAAGCGGTTCTTTAAGAACGTATGCGTGTTCAAGCCCTCGCAACTCCAGCATTGAAGCCTTCGTGAGAGTTTTGTCTGCCCGATGGCTAAAGCCTTGCAACCTGACGACCGAATGAATGGCACGATCAACCCGAGTCGTTTCAAGTTCCCTTTGTTGCCTACAAGAGTTGGACTCGGATCGCACATACGAAAGAGCCAGTGCAGCAACCCTTGACCGCCTATCAGGACATTCTGCAGAAGAAGGCATTCGCGTTATTCACGATG

Full Affymetrix probeset data:

Annotations for 1624669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720