FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624670_at:

>probe:Drosophila_2:1624670_at:610:727; Interrogation_Position=1061; Antisense; TTGTCAACACCATTTGGCGCCGCAA
>probe:Drosophila_2:1624670_at:358:569; Interrogation_Position=1194; Antisense; GGCTAGATCGTGTTCCAGTTTGGAC
>probe:Drosophila_2:1624670_at:692:397; Interrogation_Position=1216; Antisense; GACAACATTGTTTCCAGCACGGAGA
>probe:Drosophila_2:1624670_at:498:67; Interrogation_Position=1256; Antisense; ATGGCACTGTGAATCAGGGCTTCAA
>probe:Drosophila_2:1624670_at:218:347; Interrogation_Position=1296; Antisense; GCATCCCAATTTACCCATCATAAGA
>probe:Drosophila_2:1624670_at:249:625; Interrogation_Position=1327; Antisense; TGCGCCGAGGCAGATACAGTGTCTA
>probe:Drosophila_2:1624670_at:686:153; Interrogation_Position=1342; Antisense; ACAGTGTCTATCTGCAGTGCGCGTA
>probe:Drosophila_2:1624670_at:191:507; Interrogation_Position=1358; Antisense; GTGCGCGTACGAACAACGATCATAT
>probe:Drosophila_2:1624670_at:713:55; Interrogation_Position=1432; Antisense; ATGACACCGCAGGAGATCGCCATGT
>probe:Drosophila_2:1624670_at:307:325; Interrogation_Position=1473; Antisense; GCGATTTCTTTTTCCGGCCATGTTC
>probe:Drosophila_2:1624670_at:689:709; Interrogation_Position=1504; Antisense; TTCAACGCTCTGTATTGGACCTTCG
>probe:Drosophila_2:1624670_at:412:3; Interrogation_Position=1517; Antisense; ATTGGACCTTCGTCTATGTTTTGTA
>probe:Drosophila_2:1624670_at:525:135; Interrogation_Position=946; Antisense; ACGCTTTCCTCATCGCAGAGCAAGA
>probe:Drosophila_2:1624670_at:643:379; Interrogation_Position=969; Antisense; GAACCTGCCCAAGGTGAGCTACATA

Paste this into a BLAST search page for me
TTGTCAACACCATTTGGCGCCGCAAGGCTAGATCGTGTTCCAGTTTGGACGACAACATTGTTTCCAGCACGGAGAATGGCACTGTGAATCAGGGCTTCAAGCATCCCAATTTACCCATCATAAGATGCGCCGAGGCAGATACAGTGTCTAACAGTGTCTATCTGCAGTGCGCGTAGTGCGCGTACGAACAACGATCATATATGACACCGCAGGAGATCGCCATGTGCGATTTCTTTTTCCGGCCATGTTCTTCAACGCTCTGTATTGGACCTTCGATTGGACCTTCGTCTATGTTTTGTAACGCTTTCCTCATCGCAGAGCAAGAGAACCTGCCCAAGGTGAGCTACATA

Full Affymetrix probeset data:

Annotations for 1624670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720