FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624671_at:

>probe:Drosophila_2:1624671_at:189:637; Interrogation_Position=1005; Antisense; TCGACATCATCGCATATATCCGGTG
>probe:Drosophila_2:1624671_at:277:23; Interrogation_Position=1020; Antisense; ATATCCGGTGTTTGGCAAGCGCAGC
>probe:Drosophila_2:1624671_at:667:205; Interrogation_Position=1036; Antisense; AAGCGCAGCATTCCGGATGCAGCCA
>probe:Drosophila_2:1624671_at:685:433; Interrogation_Position=1088; Antisense; GAGTGGCCACTGAGCATGAGGACAA
>probe:Drosophila_2:1624671_at:654:551; Interrogation_Position=1125; Antisense; GGAGCAACTCCAGATCAAGCACCAT
>probe:Drosophila_2:1624671_at:294:351; Interrogation_Position=1157; Antisense; GCAGACAGTCCTTGTACGAGCGAAT
>probe:Drosophila_2:1624671_at:84:559; Interrogation_Position=1194; Antisense; GGACAAACGAGGTCACCATGGCCAC
>probe:Drosophila_2:1624671_at:413:69; Interrogation_Position=1211; Antisense; ATGGCCACCACTGCGTATTGCGAAC
>probe:Drosophila_2:1624671_at:233:481; Interrogation_Position=1225; Antisense; GTATTGCGAACCCTCTGCGAAACGG
>probe:Drosophila_2:1624671_at:570:197; Interrogation_Position=1245; Antisense; AACGGGCCAGAAATCGACGGAGCAT
>probe:Drosophila_2:1624671_at:380:193; Interrogation_Position=1292; Antisense; AACTAATGCGTGCAGTGTTCACCCT
>probe:Drosophila_2:1624671_at:356:559; Interrogation_Position=1320; Antisense; GGAAGCCATGGACAACGAACCGGTT
>probe:Drosophila_2:1624671_at:478:521; Interrogation_Position=1428; Antisense; GTGGCAGGCCCAGTTCATACAATAA
>probe:Drosophila_2:1624671_at:119:323; Interrogation_Position=931; Antisense; GCGCAGCGACGACAGGACAGTACCA

Paste this into a BLAST search page for me
TCGACATCATCGCATATATCCGGTGATATCCGGTGTTTGGCAAGCGCAGCAAGCGCAGCATTCCGGATGCAGCCAGAGTGGCCACTGAGCATGAGGACAAGGAGCAACTCCAGATCAAGCACCATGCAGACAGTCCTTGTACGAGCGAATGGACAAACGAGGTCACCATGGCCACATGGCCACCACTGCGTATTGCGAACGTATTGCGAACCCTCTGCGAAACGGAACGGGCCAGAAATCGACGGAGCATAACTAATGCGTGCAGTGTTCACCCTGGAAGCCATGGACAACGAACCGGTTGTGGCAGGCCCAGTTCATACAATAAGCGCAGCGACGACAGGACAGTACCA

Full Affymetrix probeset data:

Annotations for 1624671_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720