FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624673_at:

>probe:Drosophila_2:1624673_at:300:285; Interrogation_Position=2477; Antisense; CTGATGGCCGCCGAAGAGAAGCTAA
>probe:Drosophila_2:1624673_at:73:387; Interrogation_Position=2507; Antisense; GAAAAGGACATTACTTCCAACGAGA
>probe:Drosophila_2:1624673_at:96:617; Interrogation_Position=2541; Antisense; TGCACGAGCAGCGATGTGTGGTCAA
>probe:Drosophila_2:1624673_at:576:609; Interrogation_Position=2571; Antisense; TGACCACAGCCCTTGGCTTGGACAA
>probe:Drosophila_2:1624673_at:526:9; Interrogation_Position=2619; Antisense; ATTCACTAAACAACTCCATAGCCTC
>probe:Drosophila_2:1624673_at:523:161; Interrogation_Position=2651; Antisense; AAATAGGCATTCTCGTTGTCCTCGT
>probe:Drosophila_2:1624673_at:203:633; Interrogation_Position=2695; Antisense; TCCGTATTTATTCTGCGCGAGCATT
>probe:Drosophila_2:1624673_at:61:641; Interrogation_Position=2706; Antisense; TCTGCGCGAGCATTTGATCAACTTG
>probe:Drosophila_2:1624673_at:581:453; Interrogation_Position=2721; Antisense; GATCAACTTGGTCTAATCGTCCTAC
>probe:Drosophila_2:1624673_at:479:277; Interrogation_Position=2742; Antisense; CTACCGCTGTCAAATCCTGTTAACA
>probe:Drosophila_2:1624673_at:260:655; Interrogation_Position=2873; Antisense; TAATTTTTCACCGTTGAGGCGACAT
>probe:Drosophila_2:1624673_at:221:439; Interrogation_Position=2888; Antisense; GAGGCGACATTAGTTTTTCTTCATT
>probe:Drosophila_2:1624673_at:57:707; Interrogation_Position=2911; Antisense; TTAGTAACAGCAACATTTCCACGAT
>probe:Drosophila_2:1624673_at:378:19; Interrogation_Position=2925; Antisense; ATTTCCACGATAAACCAAGGCAGAC

Paste this into a BLAST search page for me
CTGATGGCCGCCGAAGAGAAGCTAAGAAAAGGACATTACTTCCAACGAGATGCACGAGCAGCGATGTGTGGTCAATGACCACAGCCCTTGGCTTGGACAAATTCACTAAACAACTCCATAGCCTCAAATAGGCATTCTCGTTGTCCTCGTTCCGTATTTATTCTGCGCGAGCATTTCTGCGCGAGCATTTGATCAACTTGGATCAACTTGGTCTAATCGTCCTACCTACCGCTGTCAAATCCTGTTAACATAATTTTTCACCGTTGAGGCGACATGAGGCGACATTAGTTTTTCTTCATTTTAGTAACAGCAACATTTCCACGATATTTCCACGATAAACCAAGGCAGAC

Full Affymetrix probeset data:

Annotations for 1624673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720